ID: 1093288751

View in Genome Browser
Species Human (GRCh38)
Location 12:17298123-17298145
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 11, 1: 26, 2: 50, 3: 50, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093288751_1093288756 17 Left 1093288751 12:17298123-17298145 CCACCACAGTGGTTAAGAGGACA 0: 11
1: 26
2: 50
3: 50
4: 158
Right 1093288756 12:17298163-17298185 TGGCAAAAGGACAGACAGCCAGG No data
1093288751_1093288754 -3 Left 1093288751 12:17298123-17298145 CCACCACAGTGGTTAAGAGGACA 0: 11
1: 26
2: 50
3: 50
4: 158
Right 1093288754 12:17298143-17298165 ACAGGCAGCAGCAGTACTAGTGG No data
1093288751_1093288755 4 Left 1093288751 12:17298123-17298145 CCACCACAGTGGTTAAGAGGACA 0: 11
1: 26
2: 50
3: 50
4: 158
Right 1093288755 12:17298150-17298172 GCAGCAGTACTAGTGGCAAAAGG No data
1093288751_1093288757 18 Left 1093288751 12:17298123-17298145 CCACCACAGTGGTTAAGAGGACA 0: 11
1: 26
2: 50
3: 50
4: 158
Right 1093288757 12:17298164-17298186 GGCAAAAGGACAGACAGCCAGGG No data
1093288751_1093288758 22 Left 1093288751 12:17298123-17298145 CCACCACAGTGGTTAAGAGGACA 0: 11
1: 26
2: 50
3: 50
4: 158
Right 1093288758 12:17298168-17298190 AAAGGACAGACAGCCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093288751 Original CRISPR TGTCCTCTTAACCACTGTGG TGG (reversed) Intergenic
900202589 1:1417543-1417565 TGTTCTCTTAACTACCGTAGGGG + Intergenic
902073403 1:13762365-13762387 TGTCCCCTTCCCCAGTGTGGTGG - Intronic
902383681 1:16064601-16064623 TGTCCCCTTTACCACTGGGTGGG + Intronic
902986087 1:20155139-20155161 TATCCTCTTAACCACTGTGGGGG - Intergenic
903484105 1:23676828-23676850 TAGACTCTTGACCACTGTGGAGG + Intergenic
903593236 1:24473263-24473285 TGTGCTTTTAACCACGGTGAAGG - Intergenic
903770801 1:25763144-25763166 TGTAGTCTTAACTACTGAGGAGG + Intronic
904915769 1:33969702-33969724 TGTGCTCTTAGCCACTGTGCTGG + Intronic
905621128 1:39449180-39449202 AATCCTCATAACCACTGAGGTGG + Intronic
908884958 1:68778502-68778524 AGTCCTCTTAAAAGCTGTGGGGG + Intergenic
911973886 1:104467297-104467319 TGTACTCTTAGCCACTGTGGGGG + Intergenic
912815853 1:112827445-112827467 TGTTCTCTCAACCACTGTGGGGG - Intergenic
912980604 1:114368266-114368288 TGTCCTCTTAAGCACTGTGGGGG + Intergenic
915925626 1:160016998-160017020 TGTGGTCTTAACCACTTGGGAGG + Intergenic
916499240 1:165372713-165372735 AGTCTTCATAATCACTGTGGAGG - Intergenic
917263238 1:173192053-173192075 TGTAATCTTAGCCACTGGGGAGG + Intronic
917326111 1:173834491-173834513 GGTCCTCTTAAACAATGTGGGGG - Exonic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
919296006 1:195701080-195701102 TGTACTTTTAACCACTGTGTTGG - Intergenic
920450127 1:206053828-206053850 TGTTCTCTTAACTACGTTGGCGG - Intronic
921747479 1:218754112-218754134 TGTCCTCTTAGCCACTGTGGGGG + Intergenic
923155740 1:231277717-231277739 ACGCCTTTTAACCACTGTGGTGG - Exonic
1066389868 10:34970033-34970055 TGCCCTCTTAGTCACTGTGGGGG - Intergenic
1069617204 10:69813784-69813806 TGTCCCTTTAACCCCTTTGGTGG + Intronic
1069939011 10:71940709-71940731 TGTCCTCTTAACCACTGTGAGGG - Intergenic
1071281699 10:84109718-84109740 TGTCCTCTTAATTACCGTGGGGG - Intergenic
1071288459 10:84171037-84171059 TGTTCTTTTAACTACTGTGGAGG + Intergenic
1072334545 10:94385775-94385797 TGTTCTCTCAACCGCTGGGGGGG - Intergenic
1072689216 10:97560495-97560517 TGTTATTTTAACTACTGTGGAGG + Intronic
1075141822 10:119844559-119844581 TGTGCTCTTAACCTCTGTGATGG + Intronic
1076597344 10:131632191-131632213 TGTCCTCGTCACCACAGTAGAGG - Intergenic
1077589546 11:3480892-3480914 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1081480154 11:43478748-43478770 TGTCGTCCTAACTACTTTGGGGG - Intronic
1083178267 11:60966811-60966833 TGGGCTCTTAACCACAGGGGTGG - Intergenic
1083197120 11:61094980-61095002 TGTCCTCTTAACCACTGCGGGGG - Intergenic
1084245267 11:67852666-67852688 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1084827421 11:71741912-71741934 TGCCCTCTTAGCCACAGTGGGGG - Intergenic
1086973644 11:93109571-93109593 TGTTCTCTCAACCACTGTGTGGG + Intergenic
1087504534 11:99002656-99002678 TATTCTCTAAATCACTGTGGTGG - Intergenic
1087684317 11:101245824-101245846 AGTTCTCTCAACCACTGTGGAGG - Intergenic
1087894603 11:103573325-103573347 TGTTCTCTTAACCACTGTGGCGG - Intergenic
1090665341 11:128911498-128911520 TGACCTCTTCACCACCCTGGTGG + Exonic
1091743642 12:2977151-2977173 TGTCCTCCCAACCACTGAAGAGG - Intronic
1092415837 12:8289798-8289820 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1093267950 12:17024867-17024889 TGTCCCCTTAATCAATATGGAGG - Intergenic
1093288751 12:17298123-17298145 TGTCCTCTTAACCACTGTGGTGG - Intergenic
1093499169 12:19791464-19791486 TTTCCTTTTAACCATTCTGGTGG - Intergenic
1094369051 12:29716138-29716160 TGTGCTCTTAGCTACTGGGGAGG - Intronic
1095414507 12:41961791-41961813 TGTGCTCTTAACCACAGATGAGG + Intergenic
1095877375 12:47096522-47096544 TGTCCTCTTAAGCACATTGAGGG + Intronic
1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG + Intergenic
1098248192 12:68541511-68541533 TGTTCTCTCAGCCACTGTGGCGG - Intergenic
1098336275 12:69408064-69408086 TGTTATGTTAACCACTGGGGTGG + Intergenic
1098639571 12:72823339-72823361 TGTTCTCTTAACTACTGTGGGGG + Intergenic
1098748100 12:74265570-74265592 TGTCTTCTTAACCACTGTGGGGG - Intergenic
1099002681 12:77198993-77199015 TGTAGTCTCAACCACTTTGGAGG - Intergenic
1101029780 12:100647338-100647360 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1101125045 12:101624607-101624629 TGTAGTCTTAACCACTTGGGAGG - Intronic
1101648861 12:106656576-106656598 CATCCTCTTCACCACAGTGGGGG + Intronic
1101960042 12:109242265-109242287 TCCCTTCTTCACCACTGTGGAGG - Intronic
1102944437 12:116973647-116973669 TGTCCTCTTCAGCACTGTCAAGG + Intronic
1103544836 12:121692686-121692708 TGTCATCTCAGCCACTCTGGAGG - Intergenic
1104292335 12:127482050-127482072 TGTCCTCTTAACCACTGTCAGGG - Intergenic
1104993728 12:132641471-132641493 TATTGTCTTTACCACTGTGGGGG - Intronic
1105012763 12:132766612-132766634 TGCCCTCTTCACCTCTGTGTGGG - Intergenic
1105498244 13:20949401-20949423 TGTCATCTATGCCACTGTGGAGG - Intergenic
1105629822 13:22151691-22151713 TATCCTCTTCACCATTGTGATGG - Intergenic
1105695564 13:22884821-22884843 TGTTCTCTTAACTTCTGTAGGGG - Intergenic
1106535911 13:30642800-30642822 TGTTCTCTTAACCTTAGTGGTGG - Intronic
1107491048 13:40880070-40880092 TGTCCTCTTAACCACGGTGGGGG + Intergenic
1107561203 13:41559006-41559028 TATCCTCACAGCCACTGTGGTGG - Intergenic
1108044820 13:46373722-46373744 TCTCCTGTTCACCACTGTGCAGG - Intronic
1109802476 13:67398453-67398475 TGTCCTCTTAACCAATGTAGGGG - Intergenic
1112334672 13:98504485-98504507 ATTGCTGTTAACCACTGTGGTGG - Intronic
1113183909 13:107664247-107664269 TGTCCACTTATCTACTGTGTTGG + Intronic
1116431733 14:44854058-44854080 AGTCCTCTCACCCACTCTGGAGG - Intergenic
1116655736 14:47651415-47651437 TCTCCCTTTAAGCACTGTGGTGG - Intronic
1117226856 14:53670117-53670139 CGTCCCCTTAACCACTGTACTGG + Intergenic
1117955480 14:61120259-61120281 TGTCCTCTCAACCACTGTGGGGG + Intergenic
1120743783 14:88135572-88135594 TGTCCTCTTTACCACTCCGAGGG + Intergenic
1120813626 14:88830337-88830359 TGTCCTGTTACCCACTTTGAGGG + Intronic
1121945021 14:98111668-98111690 TGTCCCAGTAACCACTGTGCAGG + Intergenic
1126166855 15:45660810-45660832 TGTCCTCTTCACCTCTCTGTGGG + Intronic
1129303711 15:74642819-74642841 TGTACTCTTAAGGACTGTGAGGG - Intronic
1130262041 15:82362877-82362899 TGTCCCTTTGACCAGTGTGGGGG + Intergenic
1130279191 15:82506130-82506152 TGTCCCTTTGACCAGTGTGGGGG - Intergenic
1132203586 15:99971366-99971388 TGTCTCCTTCCCCACTGTGGTGG - Intergenic
1132859248 16:2061906-2061928 TGACCTGTTGACCACGGTGGAGG + Exonic
1134317416 16:13131874-13131896 TCCCTTATTAACCACTGTGGTGG + Intronic
1134442101 16:14304325-14304347 TGTCCCTTAAACCACTGTGGGGG - Intergenic
1135730288 16:24889358-24889380 TGTAGTCTTAACTACTCTGGAGG + Intronic
1137029048 16:35505800-35505822 TCTCCTCTTTATCACAGTGGCGG + Intergenic
1137041792 16:35620044-35620066 TGTTCTCTCAACCACTGTGGTGG + Intergenic
1138845902 16:60565687-60565709 TGTCTTTTCAACCACTGTTGGGG + Intergenic
1139461352 16:67125141-67125163 TGTCCTCATAACAACCCTGGAGG + Intronic
1140079617 16:71732860-71732882 TGTCCTCTCCTCCACTGTTGAGG - Exonic
1140755047 16:78059310-78059332 TGCCCTCTTAACCACTGTGGGGG + Intronic
1141737957 16:85867710-85867732 TGTCCTTCTTTCCACTGTGGAGG + Intergenic
1142923991 17:3216540-3216562 TCTCCTCGTAACCAATGTGAGGG + Exonic
1145865400 17:28238000-28238022 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1146564689 17:33902497-33902519 TGTCCACTTCAGCACTGTGGTGG + Intronic
1146763943 17:35501887-35501909 TGTTCTCTCAACCACTGTGGGGG - Intronic
1146893571 17:36524880-36524902 TGTGTTCTTAACCACTATGCTGG + Intronic
1147255854 17:39181570-39181592 CCTCCTCTTAACCTCAGTGGGGG + Intronic
1147443239 17:40460179-40460201 GGTCCTCTTTCCCAGTGTGGGGG + Intergenic
1147552332 17:41452492-41452514 GGTCCACTTAACCACTGTGTTGG - Intergenic
1149320322 17:55475051-55475073 TGTCCTCTTAAACACTGTGGGGG - Intergenic
1149401155 17:56297175-56297197 TGGCCTCTGAAGCTCTGTGGTGG + Intronic
1152164991 17:78697811-78697833 TGTCCCCATAACCACTGGGAGGG - Intronic
1152453495 17:80398613-80398635 TGTTCTCTCAACCACTGTTGGGG - Exonic
1153413098 18:4815991-4816013 GGTCCTCTTCCACACTGTGGAGG + Intergenic
1153830183 18:8914930-8914952 TGTTCTCTCAACCACTTTGGTGG - Intergenic
1158291707 18:55951669-55951691 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1162284718 19:9729594-9729616 TGTCATCTTAACCACTGTGGGGG + Intergenic
1162633442 19:11946504-11946526 TGTCCTCTCAACCACTGTGGGGG + Intronic
1163916478 19:20244951-20244973 TGTCCTCTCAACCACTGTGGGGG - Intergenic
1163934558 19:20431154-20431176 TGTTCTCTTAATTACTGTAGGGG + Intergenic
1163943713 19:20517262-20517284 TGTCCTCTTAACTACTGTGGGGG + Intergenic
1163966895 19:20754298-20754320 TGCCCTCTTAGCCACTGTGGGGG + Intronic
1163991601 19:21003658-21003680 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1164217536 19:23162971-23162993 TGTTCTCTCAACCACTGTGGGGG + Intergenic
1164480485 19:28607785-28607807 TGTCCTCTTAACCACCATGGGGG - Intergenic
1164821307 19:31253450-31253472 TTTTCTGTTAACCCCTGTGGAGG - Intergenic
1166838207 19:45680403-45680425 TGTAGTCTTAGCCACTCTGGAGG + Intronic
1167717236 19:51151507-51151529 TGTGATCTTATCCACTGTGTTGG - Intronic
1167935474 19:52903402-52903424 TGTTCTTTTAACTACTGTGGGGG + Intergenic
1168469416 19:56628635-56628657 TGTCCTCCCAGCCACTCTGGAGG + Intergenic
927484615 2:23479945-23479967 TGTCCTCATAAGCAGCGTGGTGG + Intronic
929349943 2:40938475-40938497 TGTCCTAATAACCACAGTGAGGG + Intergenic
930324416 2:49897382-49897404 TCTCCTATTAACCACTATGTAGG + Intergenic
930517965 2:52432045-52432067 TGTCCTCTTAACCACTGTGGGGG - Intergenic
931699577 2:64898755-64898777 TGTCCTCTTAACCACGGTGCAGG + Intergenic
932352938 2:71046598-71046620 TGGCCTCTTAGCCACTGTGGGGG - Intergenic
933783345 2:85817578-85817600 TGCTCTCTTAACCACGGTGTCGG + Intergenic
933936014 2:87204325-87204347 TGTCCTCTTAACGACTGTGGGGG + Intergenic
934591234 2:95551685-95551707 TGCCCTCTTAGCCACTTTGGGGG - Intergenic
934723786 2:96601947-96601969 TGTTCTCTCAACCTCTCTGGGGG + Intronic
936357134 2:111761504-111761526 TGTCCTCTTAACGACTGTAGGGG - Intergenic
938702946 2:133895259-133895281 TGTCATCTTAACCACTGTCGGGG - Intergenic
939537944 2:143455801-143455823 TTTCCTTTTAAACACTTTGGTGG - Intronic
940873868 2:158881898-158881920 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
941757409 2:169202567-169202589 TGTGCTCTTAACCACTACAGAGG + Intronic
944291139 2:198006477-198006499 TTTCCTCTTAAGAACTCTGGAGG + Intronic
947594440 2:231402021-231402043 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
1170401124 20:15984906-15984928 TGTTCTCTTAACTGCTGTTGGGG + Intronic
1171407354 20:24920545-24920567 TGCCCTTTTAGCCACTGTGGGGG - Intergenic
1172065104 20:32213953-32213975 TGTTCCCTTAACAACTGTTGTGG + Intronic
1175539126 20:59737181-59737203 TGTCCTGTTCCCCACTGGGGCGG + Intronic
1175716316 20:61256528-61256550 TGTGCTCTTGATCAGTGTGGTGG + Intronic
1175730498 20:61350569-61350591 TGGCCTCTGCAGCACTGTGGGGG - Intronic
1176081284 20:63274449-63274471 AGTCCTCTTAAACACAGTGAAGG + Intronic
1177355285 21:19998906-19998928 TGCCCTCTTAGCCACTGAGAGGG + Intergenic
1177837755 21:26204372-26204394 TGTCCTCTGAAACAGTCTGGAGG - Intergenic
1178047424 21:28711206-28711228 TGTCCTCTTAATTATTTTGGAGG + Intergenic
1182213788 22:28699124-28699146 TGTGGTCTTAGCCACTCTGGAGG - Intronic
1183737724 22:39653137-39653159 AGCCCTCTTAGCCACTGTGTGGG - Intronic
949157592 3:847883-847905 TGTCCTCTTAACCACTGTGGTGG - Intergenic
951166513 3:19489379-19489401 TGTCCTCTTAACCACTGTGAGGG + Intronic
954666881 3:52259169-52259191 TTTCCTTTTATCCCCTGTGGGGG - Intronic
956995971 3:74826323-74826345 TGTTCTCTTAACTACCGTGGGGG - Intergenic
957405763 3:79774162-79774184 TGTCCTCTTAACCGCTGTGGGGG - Intergenic
958000145 3:87740049-87740071 AGTTCTTTCAACCACTGTGGAGG + Intergenic
959421276 3:106132483-106132505 TGAGCTCTAAACCACTCTGGTGG + Intergenic
960698700 3:120419902-120419924 TGTCCTCACAACCTCTGTGCAGG + Intronic
961271716 3:125694572-125694594 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
961893383 3:130148411-130148433 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
964522931 3:157586709-157586731 TATCCTCTTAACCACTGTAGGGG + Intronic
967119165 3:186367365-186367387 TCTCCTGTTAACCAATTTGGGGG + Intergenic
968541501 4:1170672-1170694 TGCCCTCTGCACCACTGTTGGGG + Intronic
969381454 4:6801560-6801582 TGTCGTCTTAGCTACTCTGGAGG + Intronic
969749382 4:9098732-9098754 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
970937689 4:21593675-21593697 TGTCCTCTTAAACAAGGTGTGGG - Intronic
970940751 4:21630341-21630363 TGTCATCCTAGCTACTGTGGAGG + Intronic
971027286 4:22600666-22600688 TGTTCTCTTAACTACTGTGGAGG - Intergenic
972076968 4:35101815-35101837 TGTCCCCTTAACCACTGCGGGGG - Intergenic
972514556 4:39799924-39799946 CATGCTTTTAACCACTGTGGTGG + Intergenic
974949866 4:68575245-68575267 TGTTCTCTTAACTATTGTGAGGG + Intronic
974987935 4:69052273-69052295 TGTTCTCTTAACTACTGTTGGGG - Intronic
975205452 4:71639586-71639608 TGTTCTCTCAACCACTGTAGGGG - Intergenic
976970525 4:91096461-91096483 TGTCCCCTTAACCACTATGGGGG + Intronic
977043783 4:92044904-92044926 TGTTCTCTTAACCACTGTTGGGG + Intergenic
977140817 4:93369608-93369630 TGTCCTCTAAACTACTTGGGAGG - Intronic
977972161 4:103224891-103224913 TATTCTCTCAACCACTGTGGTGG - Intergenic
978222828 4:106297743-106297765 TATACTCTTAACCACTATGTGGG - Intronic
980038643 4:127913921-127913943 TGTATTCTTAACTACTCTGGAGG - Intergenic
980072807 4:128261291-128261313 TGTTCTCTCAACCACTGTGGTGG - Intergenic
980779623 4:137479574-137479596 TGTCCTCTTAACCACTCTGGGGG - Intergenic
981604449 4:146527171-146527193 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
981746392 4:148056243-148056265 AGTGCAGTTAACCACTGTGGTGG + Intronic
982368594 4:154608019-154608041 TGTCCTCTTAACAACTATCCTGG - Intronic
987930697 5:24396759-24396781 AGTTCTCTCAACCACTGTGGAGG + Intergenic
988145431 5:27299854-27299876 TCTCCTCTTCACCACTGTGAAGG + Intergenic
989467877 5:41778365-41778387 TCCCCTCTTAACCAGTGTAGTGG - Intronic
989557551 5:42814713-42814735 TGTTCTCTTAACTACTGTAGCGG - Intronic
989776017 5:45207531-45207553 TGTTCTCTTAACTACTGTGGTGG - Intergenic
991305855 5:65175118-65175140 TGTTCTCTCAACCACTGGTGAGG - Intronic
992989719 5:82272303-82272325 TGTTCTCTTAACTACTGTGGTGG + Intronic
995027898 5:107445727-107445749 CGTCCTCTGAACCACTTGGGAGG + Intronic
995111597 5:108435155-108435177 TGTAGTCCTAACCACTGGGGAGG - Intergenic
995473316 5:112525163-112525185 TGTCCTCTTAACCACTGTGGGGG - Intergenic
996871038 5:128193542-128193564 TGTGCTCTTAACCACTCAGCTGG + Intergenic
997390781 5:133513411-133513433 TCTGCTCTTACCCACTGTGTCGG - Intronic
999477833 5:151917649-151917671 TGTCCTCTTAACAAATGTTTGGG + Intronic
1000236629 5:159367461-159367483 TGTTCTCTCAACCACTGTTGGGG - Intergenic
1000604944 5:163318082-163318104 TGTTCTTTTAACTACTGTGGGGG + Intergenic
1001873760 5:175181548-175181570 TGACCTCTTAACCACTGGGCTGG + Intergenic
1003620333 6:7693816-7693838 TGTACTCTTAGCTACTCTGGAGG - Intergenic
1004314492 6:14574011-14574033 GGTCCTCTTTTCCTCTGTGGAGG - Intergenic
1004560296 6:16743411-16743433 GGTCCTGTGAACCACAGTGGTGG - Intronic
1004954073 6:20707530-20707552 TGTCTGCTTACCCACTGTGGTGG + Intronic
1006032215 6:31185460-31185482 TGTTCTCTTAACTACTGTAGGGG + Intergenic
1006566308 6:34960663-34960685 TGGCATCTAAAGCACTGTGGAGG - Intronic
1006570573 6:34999768-34999790 TGTTCTCTTAACTACTGTGGCGG - Intronic
1006769626 6:36541948-36541970 TGTCATCTTAACTACTTGGGAGG - Intronic
1006843400 6:37046464-37046486 TGTACTCTCAACTACTGTGGAGG + Intergenic
1008123263 6:47641668-47641690 TGTTCTCTCAACCACTGTGGGGG - Intergenic
1010317719 6:74469566-74469588 TGTTCTCTTAACTACTGTAGTGG - Intergenic
1011564799 6:88663457-88663479 TGTCCTCTTAGCCACTGTGAGGG - Intronic
1012612243 6:101230576-101230598 TGTCCTATTAACTACTGTGGGGG + Intergenic
1013559326 6:111289189-111289211 TGTTCTCTTAACTACTGTTGCGG + Intergenic
1013649601 6:112181203-112181225 TCTTCTCTAGACCACTGTGGCGG + Intronic
1014547272 6:122747968-122747990 TGTCCTCTTAACCACTGTGGGGG + Intergenic
1015323893 6:131904242-131904264 TGTCCCCTTAATCAATATGGAGG + Intergenic
1018754536 6:166837646-166837668 TGTCCTCATCACCTCTGTGGGGG + Intronic
1020323610 7:6957908-6957930 TGCCCCCTTAGCCACTGTGGGGG + Intergenic
1021849541 7:24794469-24794491 TGTCTTCTTAACCACCGTGGGGG + Intergenic
1021954131 7:25806895-25806917 TGACTTCTTAAGCACTGTGGTGG - Intergenic
1022173243 7:27849521-27849543 TGGTTTCATAACCACTGTGGTGG + Intronic
1024230060 7:47356964-47356986 TGTCGTCCTAACTACTCTGGAGG + Intronic
1024555979 7:50604072-50604094 TGTCCTGTGAATCACTGTGGGGG + Exonic
1026281112 7:68922476-68922498 TGTGCTCTTAACCACTCTGCCGG + Intergenic
1027024708 7:74842678-74842700 TGTCATCTTAGCTACTCTGGAGG - Intronic
1027063056 7:75101441-75101463 TGTCATCTTAGCTACTCTGGAGG + Intronic
1027453252 7:78357268-78357290 TCTCCCATTAAGCACTGTGGTGG + Intronic
1030627036 7:111855530-111855552 TGTGCTCTTAACATCTCTGGTGG - Intronic
1032170430 7:129579680-129579702 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1032782264 7:135172771-135172793 TGTTCTCTTAACTACTGTGGTGG - Intergenic
1032979642 7:137267379-137267401 TGTTCTCTTAACTACTGTTGGGG + Intronic
1033781139 7:144670607-144670629 TGCCCTTTTAACTACTGTGCTGG + Intronic
1034632437 7:152540944-152540966 TGTCCTGTTAAAAACTGAGGAGG - Intergenic
1035625579 8:1068409-1068431 GGAACTCTTATCCACTGTGGGGG - Intergenic
1036372453 8:8173075-8173097 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
1036493664 8:9250490-9250512 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
1036566130 8:9939649-9939671 TGTCCTCTTAACCGCAGTACAGG - Intergenic
1036817173 8:11910790-11910812 TGCCCTCTCAGCCACTGTGGGGG + Intergenic
1036817514 8:11913101-11913123 TGCCCTCTCAGCCACTGTTGGGG + Intergenic
1036820472 8:11935681-11935703 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1036878450 8:12492566-12492588 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1037666978 8:20978367-20978389 TCTCCTCTAAACGACTCTGGAGG + Intergenic
1037861363 8:22407830-22407852 TGTACTCTCAACTACTGAGGAGG - Intronic
1039498630 8:38000001-38000023 TGTCCTCTACTCCACTGTGCTGG + Intergenic
1039814734 8:41083215-41083237 TGTTAGCTTAACCACTGTGCAGG + Intergenic
1039877041 8:41595895-41595917 TGTTCTCTCAACCACTGTGGCGG + Intronic
1040622095 8:49102454-49102476 GGTCCTCTTCCACACTGTGGAGG - Intergenic
1047014523 8:120709702-120709724 TTTCCTCTTTCCCACTGTGTTGG + Intronic
1047388060 8:124427713-124427735 TGTCCTATTAACAAATGTAGTGG - Intergenic
1049087489 8:140489953-140489975 GGTCCTCTTCCACACTGTGGAGG - Intergenic
1051511893 9:17887573-17887595 TGTAGTCTTAGCTACTGTGGGGG + Intergenic
1052464520 9:28813636-28813658 TGTCCTCAGAATCACTGTGAGGG - Intergenic
1056252846 9:84768471-84768493 TGTCCTCTGAACCCCTGAGATGG + Intronic
1057601539 9:96462489-96462511 TGTGATCTCAACCACTGAGGAGG + Intronic
1061102309 9:128501520-128501542 TGTGCTCTCAGCTACTGTGGAGG - Intergenic
1061321655 9:129834881-129834903 CGTCCTCTGGACCACTGTGCTGG - Intronic
1061508550 9:131046661-131046683 TTTGCCCTTAACCGCTGTGGTGG + Intronic
1062224729 9:135443300-135443322 TGCCCTCTTAGCCACTGTGGGGG + Intergenic
1185909437 X:3968690-3968712 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1186558769 X:10588731-10588753 TGTTCTCTTAACTACTGTGGGGG + Intronic
1187308424 X:18118017-18118039 TGCACTCTTAAACATTGTGGTGG - Intergenic
1189550081 X:42083775-42083797 TTACCTCTTAACCACTGTTGAGG + Intergenic
1190315455 X:49147684-49147706 TGTCCTCTTAACCACTGTAGGGG + Intergenic
1190370985 X:49740434-49740456 TGTACTCTCAGCCACTTTGGGGG - Intergenic
1190426368 X:50337420-50337442 TGTCCTCTTAACCACTGTGGGGG + Intronic
1190771006 X:53513959-53513981 TGTTTTCTCAACCACTGTGGTGG - Intergenic
1191036532 X:56030891-56030913 TGTCCTGTTAACCACTGTGGGGG + Intergenic
1191918176 X:66224983-66225005 TGCTCTCTCAACCACTGTGGTGG + Intronic
1193069670 X:77294834-77294856 TGCCCTCTTAACCACTGAGGGGG - Intergenic
1193713504 X:84907746-84907768 TGACCTCTTAACCAAAGTTGAGG - Intergenic
1194399986 X:93430979-93431001 TGCCCTCTTAGCCACTGCGGGGG - Intergenic
1196195248 X:112832569-112832591 TGTCCTCTTAAAAACTGGAGGGG - Intronic
1196460300 X:115922931-115922953 TGTTCTCTCAACCACCGTGGGGG + Intergenic
1198969552 X:142266434-142266456 TGTCCCTTTAACCACTGCAGGGG - Intergenic
1200394611 X:155976398-155976420 TGTCCTCTTAACCACTGTCGGGG + Intergenic
1200925113 Y:8647407-8647429 TGACCTCTTAACTACTGTGGAGG - Intergenic
1200932964 Y:8713961-8713983 TGTCCTCTTAACCACTGTGAGGG - Intergenic
1200942916 Y:8804277-8804299 TGTCCTCTTAACTACTGTGGGGG - Intergenic
1200947812 Y:8864050-8864072 TGCCCTCTTAGCCACTGTGGGGG - Intergenic
1200984068 Y:9287804-9287826 TGTCCTCTTCACCACTGTGCAGG + Intergenic
1201260265 Y:12152525-12152547 TGTTCTCTCAACCACTGTGAGGG + Intergenic
1201270195 Y:12246769-12246791 TGTCCTCTTAACCACTGTGGGGG - Intergenic
1201372843 Y:13283712-13283734 TGTTCTCTTAACTACTGTTAGGG - Intronic
1201554654 Y:15255674-15255696 TATCCTCTTAAAAATTGTGGGGG - Intergenic
1201680995 Y:16643493-16643515 TGTCCCCTTAACCACTGCAGGGG + Intergenic
1202036788 Y:20644492-20644514 TGTCCTCTCAACCATCTTGGTGG - Intergenic
1202126380 Y:21572438-21572460 TGTCCTCTTAACCACTGTGCAGG - Intergenic
1202152619 Y:21856966-21856988 TATCCTCTTAATCACTGTGCAGG + Intergenic