ID: 1093294195

View in Genome Browser
Species Human (GRCh38)
Location 12:17367598-17367620
Sequence CTGTACACCTTGACTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093294195_1093294198 16 Left 1093294195 12:17367598-17367620 CCATCATCAGTCAAGGTGTACAG No data
Right 1093294198 12:17367637-17367659 TCTAAGGAGAGCTGTATTCAAGG No data
1093294195_1093294196 0 Left 1093294195 12:17367598-17367620 CCATCATCAGTCAAGGTGTACAG No data
Right 1093294196 12:17367621-17367643 CAACTGCAATGCAGCCTCTAAGG No data
1093294195_1093294199 23 Left 1093294195 12:17367598-17367620 CCATCATCAGTCAAGGTGTACAG No data
Right 1093294199 12:17367644-17367666 AGAGCTGTATTCAAGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093294195 Original CRISPR CTGTACACCTTGACTGATGA TGG (reversed) Intergenic
No off target data available for this crispr