ID: 1093295434

View in Genome Browser
Species Human (GRCh38)
Location 12:17384092-17384114
Sequence GAGACCTATGCCAATACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 2, 2: 3, 3: 7, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093295434_1093295447 17 Left 1093295434 12:17384092-17384114 CCTCCAGTATTGGCATAGGTCTC 0: 1
1: 2
2: 3
3: 7
4: 65
Right 1093295447 12:17384132-17384154 ACCTTCATCACTGTGACCAGGGG 0: 6
1: 3
2: 2
3: 11
4: 153
1093295434_1093295446 16 Left 1093295434 12:17384092-17384114 CCTCCAGTATTGGCATAGGTCTC 0: 1
1: 2
2: 3
3: 7
4: 65
Right 1093295446 12:17384131-17384153 CACCTTCATCACTGTGACCAGGG No data
1093295434_1093295445 15 Left 1093295434 12:17384092-17384114 CCTCCAGTATTGGCATAGGTCTC 0: 1
1: 2
2: 3
3: 7
4: 65
Right 1093295445 12:17384130-17384152 CCACCTTCATCACTGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093295434 Original CRISPR GAGACCTATGCCAATACTGG AGG (reversed) Intergenic
1067335068 10:45354684-45354706 GAGACAGAAGCAAATACTGGTGG + Intergenic
1070548322 10:77470205-77470227 GTTCCCTATGCCAATCCTGGGGG + Intronic
1072252730 10:93594453-93594475 AAGACATAAGCCAATATTGGGGG - Intronic
1076222205 10:128743282-128743304 CAGACATATGCCACTGCTGGGGG - Intergenic
1080304745 11:30823986-30824008 CAGACATTTGCAAATACTGGAGG - Intergenic
1080642203 11:34164565-34164587 GAGACCTTTCCCAAAACAGGGGG - Intronic
1081406193 11:42701177-42701199 GCCACCTATGCCAATACTTTGGG + Intergenic
1081957499 11:47106397-47106419 GGGACCTAGGCCAAGACAGGCGG + Intronic
1092824685 12:12387577-12387599 GAACACTATGCCAATTCTGGGGG - Intronic
1092988077 12:13866092-13866114 GACAGCAATGCCAATGCTGGGGG + Exonic
1093295434 12:17384092-17384114 GAGACCTATGCCAATACTGGAGG - Intergenic
1093396844 12:18693321-18693343 GAGACCTATGCAGATACTGGGGG + Intronic
1097720026 12:63010431-63010453 GAGAGCTCTGCCCATACTAGAGG + Intergenic
1101884288 12:108648342-108648364 GATACCTATCCCAATCATGGTGG + Intronic
1109030621 13:57183543-57183565 CAGACCTTTGCCAATATTGTAGG - Intergenic
1112307578 13:98289136-98289158 TAGTCCTATGCCAAGACTTGTGG + Intronic
1112866955 13:103914855-103914877 AAGACCTAAGTCAATAATGGTGG + Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1120169046 14:81230946-81230968 GAGACCTATGCCATTTAGGGTGG - Intergenic
1120977717 14:90264119-90264141 GAGACCTATGCAGATATTGGGGG + Exonic
1121233360 14:92374550-92374572 GAGACCTCTGCAAATCGTGGAGG - Intronic
1124089560 15:26585442-26585464 TAGACATGTGCCAATACTGATGG + Intronic
1126766971 15:52019310-52019332 GAGACCTGAGCCGACACTGGGGG + Exonic
1137691884 16:50434085-50434107 GTGATCTATGGCAAGACTGGAGG + Intergenic
1139359932 16:66391248-66391270 GAGACCTTTGCTGACACTGGAGG - Intronic
1142747683 17:1968116-1968138 GTGACCTGTGCATATACTGGTGG + Intronic
1143149971 17:4801687-4801709 GAGACCTATGCCAAGCATGGTGG - Intergenic
1144705659 17:17366218-17366240 GTGACCGATGCCACTCCTGGTGG + Intergenic
1147854537 17:43469048-43469070 GAGTCTTATGGCAATCCTGGAGG - Intergenic
1148102251 17:45099399-45099421 GGGACCGATGCCAATACCTGTGG - Exonic
1151009114 17:70472993-70473015 GTGACATATGTGAATACTGGTGG - Intergenic
1151167560 17:72218527-72218549 GAGACCTATGCCCAGATTTGTGG - Intergenic
1165018434 19:32901964-32901986 GAGACATAAGCCAAAACTGTGGG - Intronic
926548065 2:14266851-14266873 GAGACCTTTGGCATTACTTGAGG + Intergenic
926868405 2:17385633-17385655 GAGACCTATGCCAATATTGGGGG + Intergenic
930447312 2:51489780-51489802 AAGCCCTATGCCAAAACTAGGGG + Intergenic
932692058 2:73921519-73921541 GAGGCCTTTGCCGATACAGGTGG - Intergenic
947651982 2:231794702-231794724 GTGAACTATGCCCATGCTGGAGG + Intronic
1172992796 20:39048606-39048628 GAGACCAGTGCCATTTCTGGAGG + Intergenic
1181549293 22:23627792-23627814 GAGCCCTACACCAATCCTGGAGG - Intronic
1181799319 22:25334088-25334110 GAGCCCTACACCAATCCTGGAGG + Intergenic
1181892332 22:26074444-26074466 GAGACCTATGCAGAGAATGGTGG - Intergenic
1182010208 22:26994536-26994558 AAGACCTTTGCCACTACTGCAGG - Intergenic
951668695 3:25155954-25155976 GTGACCTTTGCCAACACAGGAGG + Intergenic
956378011 3:68636248-68636270 GAGACCTATGCAGATATTGGGGG + Intergenic
957991317 3:87631056-87631078 GAGACCTATGCCAGTATTGGTGG - Intergenic
964872597 3:161329690-161329712 GAGACCTATGCTGATACTGGGGG - Intergenic
965300509 3:167000531-167000553 CAGACCTTTGCCAATAGTGTAGG - Intergenic
970484449 4:16510151-16510173 AACACCTATGCCACTTCTGGTGG + Intronic
973533496 4:51856918-51856940 GAGATCTATTCCAATGCTGGAGG - Intronic
976588742 4:86827988-86828010 TATACCTTTGCCAAGACTGGTGG + Exonic
982402157 4:154980158-154980180 GAGATCTATGCAAACACTTGAGG + Intergenic
986895220 5:12357628-12357650 GATACCTCTGCCAAAACTGATGG - Intergenic
988024833 5:25671561-25671583 GAAACTTAAGCCAATATTGGAGG - Intergenic
988604438 5:32667651-32667673 CAGACCTTTGCCAACACTGTAGG - Intergenic
989820951 5:45795616-45795638 CAGACCTTTGCCAACACTGTAGG + Intergenic
990487753 5:56276063-56276085 GAGACCTATGTCAATACTGGGGG - Intergenic
991949318 5:71932539-71932561 GTGACTCATGCCAATGCTGGTGG + Intergenic
993482093 5:88436336-88436358 GAGGCCAATGCAGATACTGGGGG + Intergenic
997215412 5:132105744-132105766 AAGAGCCATGTCAATACTGGTGG - Intergenic
997388096 5:133489606-133489628 GGGACCAATGCCAGTTCTGGTGG + Intronic
999053353 5:148547769-148547791 GTGATCTATCCCAAGACTGGAGG + Intronic
1000864072 5:166490953-166490975 GGGATCTAGGCCAAGACTGGTGG - Intergenic
1011868540 6:91862345-91862367 GAGACATATGGCTTTACTGGGGG + Intergenic
1015656824 6:135527554-135527576 GAGAAGTAAGCCAAGACTGGTGG - Intergenic
1022137435 7:27462232-27462254 GAGACCTGTGTTGATACTGGGGG + Intergenic
1031192363 7:118570120-118570142 GATACCTAGGCCAATACAAGAGG - Intergenic
1036510500 8:9395529-9395551 AAGACCTATGCCAATTTTGGGGG + Intergenic
1037059333 8:14486872-14486894 GAGATGTATGCTAATACTGTTGG - Intronic
1040393773 8:46975296-46975318 GAGACCTAAGCCGACACTGGGGG - Intergenic
1041010372 8:53536361-53536383 GAGACCTGAGCCGACACTGGGGG + Intergenic
1044255333 8:90053547-90053569 GAGAAATATGGCTATACTGGTGG - Intergenic
1053384980 9:37679949-37679971 AACACCAATGCCAACACTGGTGG - Intronic
1056905807 9:90646689-90646711 GAGACCTAGGCCAGTCCTGGAGG - Intergenic
1058907910 9:109496737-109496759 GGGACATCTGACAATACTGGAGG + Intronic
1062517426 9:136943615-136943637 GAGGCCTATGCCATGACTAGTGG - Intronic
1193315386 X:80058919-80058941 GAGAGCAAAGCCAATACTTGAGG - Intergenic
1196549783 X:117010056-117010078 GAGACTTAAGCAAAGACTGGAGG + Intergenic