ID: 1093303132

View in Genome Browser
Species Human (GRCh38)
Location 12:17478546-17478568
Sequence TGTACAATATATCTCTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093303126_1093303132 30 Left 1093303126 12:17478493-17478515 CCACTCTCTTAGCATTTTTCAAT No data
Right 1093303132 12:17478546-17478568 TGTACAATATATCTCTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093303132 Original CRISPR TGTACAATATATCTCTTGAG GGG Intergenic
No off target data available for this crispr