ID: 1093306429

View in Genome Browser
Species Human (GRCh38)
Location 12:17526706-17526728
Sequence TTACATCTGCTGAGGTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093306429_1093306433 9 Left 1093306429 12:17526706-17526728 CCTGAGCACCTCAGCAGATGTAA No data
Right 1093306433 12:17526738-17526760 CAGCACCATGCTTCCTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093306429 Original CRISPR TTACATCTGCTGAGGTGCTC AGG (reversed) Intergenic
No off target data available for this crispr