ID: 1093314728

View in Genome Browser
Species Human (GRCh38)
Location 12:17634148-17634170
Sequence CAGAACAAACAGAATGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093314728_1093314732 -5 Left 1093314728 12:17634148-17634170 CCCCCTTCATTCTGTTTGTTCTG No data
Right 1093314732 12:17634166-17634188 TTCTGACAAGTCTGCATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093314728 Original CRISPR CAGAACAAACAGAATGAAGG GGG (reversed) Intergenic
No off target data available for this crispr