ID: 1093316253

View in Genome Browser
Species Human (GRCh38)
Location 12:17654834-17654856
Sequence CATTAAACATAGATGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093316252_1093316253 -1 Left 1093316252 12:17654812-17654834 CCTCTTTTAGGAACTCATAATAC No data
Right 1093316253 12:17654834-17654856 CATTAAACATAGATGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093316253 Original CRISPR CATTAAACATAGATGAAGCC AGG Intergenic
No off target data available for this crispr