ID: 1093316802

View in Genome Browser
Species Human (GRCh38)
Location 12:17662451-17662473
Sequence ATGCATATCCAAAAATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093316802_1093316804 0 Left 1093316802 12:17662451-17662473 CCTTCCTATTTTTGGATATGCAT No data
Right 1093316804 12:17662474-17662496 ACTACATTATTTGTCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093316802 Original CRISPR ATGCATATCCAAAAATAGGA AGG (reversed) Intergenic
No off target data available for this crispr