ID: 1093323867

View in Genome Browser
Species Human (GRCh38)
Location 12:17748548-17748570
Sequence TGTAAATTTTAGTAGGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093323864_1093323867 -5 Left 1093323864 12:17748530-17748552 CCAGAGAAAAACCTTATATGTAA No data
Right 1093323867 12:17748548-17748570 TGTAAATTTTAGTAGGTATATGG No data
1093323863_1093323867 28 Left 1093323863 12:17748497-17748519 CCTGTCAATTATCACTGGAAAAA No data
Right 1093323867 12:17748548-17748570 TGTAAATTTTAGTAGGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093323867 Original CRISPR TGTAAATTTTAGTAGGTATA TGG Intergenic
No off target data available for this crispr