ID: 1093327999

View in Genome Browser
Species Human (GRCh38)
Location 12:17803362-17803384
Sequence TGTGCCCTGGGACACAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093327993_1093327999 5 Left 1093327993 12:17803334-17803356 CCGAAAGAAAGCTTAGCCACGTG No data
Right 1093327999 12:17803362-17803384 TGTGCCCTGGGACACAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093327999 Original CRISPR TGTGCCCTGGGACACAGGTG AGG Intergenic
No off target data available for this crispr