ID: 1093332347

View in Genome Browser
Species Human (GRCh38)
Location 12:17858250-17858272
Sequence GTAGTTCAGCGGCTTTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093332347_1093332351 14 Left 1093332347 12:17858250-17858272 CCCACTCAAAGCCGCTGAACTAC No data
Right 1093332351 12:17858287-17858309 ACCTGCTCCTGAATGACTACTGG 0: 7186
1: 3446
2: 1974
3: 1828
4: 2105
1093332347_1093332353 15 Left 1093332347 12:17858250-17858272 CCCACTCAAAGCCGCTGAACTAC No data
Right 1093332353 12:17858288-17858310 CCTGCTCCTGAATGACTACTGGG 0: 6882
1: 3380
2: 1919
3: 1766
4: 2040

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093332347 Original CRISPR GTAGTTCAGCGGCTTTGAGT GGG (reversed) Intergenic
No off target data available for this crispr