ID: 1093334459

View in Genome Browser
Species Human (GRCh38)
Location 12:17885460-17885482
Sequence CACTTTCCATTTGAGATCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093334459_1093334460 30 Left 1093334459 12:17885460-17885482 CCACGGATCTCAAATGGAAAGTG No data
Right 1093334460 12:17885513-17885535 TTCCTTCTATATTACATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093334459 Original CRISPR CACTTTCCATTTGAGATCCG TGG (reversed) Intergenic
No off target data available for this crispr