ID: 1093335042

View in Genome Browser
Species Human (GRCh38)
Location 12:17894630-17894652
Sequence CCTCTAGTGATGCAGTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093335042_1093335045 26 Left 1093335042 12:17894630-17894652 CCTTATAACTGCATCACTAGAGG No data
Right 1093335045 12:17894679-17894701 TTCCAGTTGCACTCTTCTAATGG No data
1093335042_1093335046 27 Left 1093335042 12:17894630-17894652 CCTTATAACTGCATCACTAGAGG No data
Right 1093335046 12:17894680-17894702 TCCAGTTGCACTCTTCTAATGGG No data
1093335042_1093335044 2 Left 1093335042 12:17894630-17894652 CCTTATAACTGCATCACTAGAGG No data
Right 1093335044 12:17894655-17894677 TTTTGTGTCTGTGTGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093335042 Original CRISPR CCTCTAGTGATGCAGTTATA AGG (reversed) Intergenic
No off target data available for this crispr