ID: 1093342074

View in Genome Browser
Species Human (GRCh38)
Location 12:17989637-17989659
Sequence CTGGGGACTAGAACAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093342074_1093342077 -5 Left 1093342074 12:17989637-17989659 CCTTACTCTGTTCTAGTCCCCAG No data
Right 1093342077 12:17989655-17989677 CCCAGATGCAGCATTTTTCTTGG No data
1093342074_1093342079 -4 Left 1093342074 12:17989637-17989659 CCTTACTCTGTTCTAGTCCCCAG No data
Right 1093342079 12:17989656-17989678 CCAGATGCAGCATTTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093342074 Original CRISPR CTGGGGACTAGAACAGAGTA AGG (reversed) Intergenic
No off target data available for this crispr