ID: 1093343951

View in Genome Browser
Species Human (GRCh38)
Location 12:18017072-18017094
Sequence TCAGCTCTAGAAGATCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 801
Summary {0: 3, 1: 11, 2: 102, 3: 216, 4: 469}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093343951 Original CRISPR TCAGCTCTAGAAGATCAGTT TGG (reversed) Intergenic
900921621 1:5675411-5675433 TCATCTCTAGAAGTTCAGGCTGG + Intergenic
904471292 1:30737999-30738021 TCTTCTCTACAAGATCATTTTGG + Intronic
904669121 1:32149184-32149206 TGAGCTCTAGAACATTTGTTTGG + Intronic
906586299 1:46982185-46982207 TCAGCTCTATTAGCTCAGTTTGG + Intergenic
906980043 1:50620397-50620419 GCAGCTCTAGAAATTCAGTTTGG + Intronic
906993723 1:50767124-50767146 TCAGCTCTATCAGATCACTTTGG - Intronic
908864516 1:68531446-68531468 TCAGCTCCATCAGATCAGTTTGG - Intergenic
909176614 1:72369964-72369986 TCACCTCTATTGGATCAGTTTGG + Intergenic
909231813 1:73100869-73100891 TCAGTTCTAGAAGTTTAGTTTGG - Intergenic
909264296 1:73536962-73536984 TCAGCTTTTTAAGATCAGTTTGG + Intergenic
909467066 1:75984500-75984522 TCAGCTCTATCAGATCAGTTTGG + Intergenic
909715309 1:78700918-78700940 TCAGCTCTATCAGATCAATTTGG + Intergenic
909992495 1:82240167-82240189 ACAGCTCTAGAACTTCAGTGAGG - Intergenic
910563730 1:88620012-88620034 CCAGCTCTATTAGATCAGTTAGG - Intergenic
910610410 1:89135002-89135024 TCAGCTCTATCAAATCAGTTTGG - Intronic
910820466 1:91339449-91339471 TCAGCTCTATCAGATCAGTTTGG - Intronic
911375083 1:97042788-97042810 TCAGCTCTAACAGGTCAGTTTGG + Intergenic
911877400 1:103185564-103185586 TCAGCTCTATTAGGTCAGTTAGG - Intergenic
911908735 1:103603312-103603334 TTAGCTCTAGAATTTTAGTTTGG + Intergenic
911914182 1:103676149-103676171 TTAGCTCTAGAATTTTAGTTTGG - Intronic
911925033 1:103818469-103818491 TCAGTTCTAGAATTTCAATTTGG - Intergenic
912193801 1:107374543-107374565 TTGGCTCTAGAAGTTCAATTTGG + Intronic
912594891 1:110864883-110864905 TCAGCTTTATCAGATCAATTTGG - Intergenic
912614492 1:111084643-111084665 TCAGCTCTATCAGATCAGTTTGG + Intergenic
913106755 1:115621831-115621853 TCATCTCTAGAAGCTCAACTTGG + Intergenic
915695588 1:157738572-157738594 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
915815886 1:158964040-158964062 TCAGCTTTATCAGATCAGTTTGG - Intronic
915817587 1:158985991-158986013 TCAGCTCTAGTAGGTTAGTTTGG + Intergenic
916268499 1:162916845-162916867 TCAGCTCTATCAGATCAGTTTGG + Intergenic
916453717 1:164948782-164948804 TCAGCTCCAGAATTTCTGTTTGG + Intergenic
916544479 1:165789733-165789755 TCATTTCTAGGAGTTCAGTTTGG + Intronic
916594967 1:166234709-166234731 TCAGTTCTATTAGTTCAGTTTGG + Intergenic
917055456 1:170977076-170977098 TCAGCTCTATCAGGCCAGTTAGG + Intronic
917572797 1:176287070-176287092 TCAGCTCTATTAGATGAGTTTGG + Intergenic
917886139 1:179386974-179386996 TCATCTCTAGAAGGTCAGTTTGG + Intronic
918153770 1:181822991-181823013 TCATCTCTAGTAGCTCAATTTGG - Intergenic
918746063 1:188201742-188201764 TGAGCTATAGAAGATCACTCAGG + Intergenic
919128270 1:193423314-193423336 TCCTCTCTAGAACAGCAGTTAGG + Intergenic
921310186 1:213834731-213834753 TCAGTTTTAGGAGATCATTTTGG - Intergenic
921767458 1:218989499-218989521 TCAGCTCTATCAGATCAGGTTGG + Intergenic
922627049 1:227058832-227058854 TCAGATCTAGATAATTAGTTTGG + Intronic
922971647 1:229746777-229746799 TGAGCTCTATCAGATCAGTTTGG + Intergenic
923100705 1:230814207-230814229 TCATCTCTAGAAGTTCAATTTGG + Intergenic
923192067 1:231628683-231628705 TCCACTCTATAAGTTCAGTTTGG - Intronic
924797157 1:247300708-247300730 ACAGCACTGGAAGCTCAGTTTGG + Exonic
924919498 1:248612695-248612717 CCAGCTCTCACAGATCAGTTTGG - Intergenic
1063859920 10:10295829-10295851 TCAGCACTAGAAGCTCTGTTTGG - Intergenic
1066153435 10:32649850-32649872 TCAGCTCAGGAAGTTCAGTTTGG + Intronic
1066752790 10:38676285-38676307 TCAGCTCTATCAGTTTAGTTTGG - Intergenic
1067052791 10:43032678-43032700 TCAGCTCTAGAATTTCTGTTTGG - Intergenic
1067276206 10:44836863-44836885 TCAGTTCTACCAAATCAGTTAGG + Intergenic
1067493984 10:46745834-46745856 TCAGTTCCAGAAGTTCAGTTTGG + Intergenic
1067600678 10:47594570-47594592 TCAGTTCCAGAAGTTCAGTTTGG - Intergenic
1067999011 10:51309842-51309864 TCATCTGTAGATGAACAGTTAGG - Intronic
1068055393 10:52006437-52006459 TCAGCTCTATCAGATTAGTTTGG - Intronic
1068218445 10:54012094-54012116 TCAGCTCTATCAGATCATTTTGG - Intronic
1068238109 10:54264566-54264588 TCAGTTCCAGAAGTTCAGTTTGG - Intronic
1068378175 10:56212291-56212313 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1068395663 10:56457881-56457903 TCAGTTCCAGAAGTTCGGTTTGG - Intergenic
1068657768 10:59592500-59592522 TCAGTTCTAGAATTTCTGTTTGG - Intergenic
1069336681 10:67359536-67359558 TCAATTCTATAAGTTCAGTTTGG - Intronic
1069356871 10:67597099-67597121 TCAGCTCTATCAGATCAGTTTGG + Intronic
1070380586 10:75877367-75877389 TCAGCTCTGGTATTTCAGTTCGG - Intronic
1070446152 10:76505598-76505620 TCAATTCCAGAAGTTCAGTTTGG + Intronic
1071230272 10:83578618-83578640 TTAGCTCTAGAAGTTCAGTTTGG + Intergenic
1071357920 10:84817225-84817247 TCAGCTCTATCAGTTCAGTATGG + Intergenic
1071652211 10:87402442-87402464 TCAGTTCCAGAACTTCAGTTTGG - Intergenic
1071772521 10:88744933-88744955 CCAGCTCTATCAGATCAATTTGG - Intronic
1071823285 10:89299159-89299181 TCAGTTCCAGAATTTCAGTTTGG - Intronic
1072026945 10:91468711-91468733 TCAGCTCTGTCAGATCAATTTGG - Intronic
1072054327 10:91739590-91739612 TTAGCTCTATCAGATCAGTTTGG + Intergenic
1072078383 10:92002086-92002108 TCATCTCTAGAAGTTCAATTTGG - Intronic
1072402855 10:95123002-95123024 TCAGCTCTATCAGATCATGTTGG + Intergenic
1072831755 10:98665099-98665121 TCAATTCTAGAAGTTAAGTTTGG - Intronic
1072839401 10:98754160-98754182 TCAACTCTATCAGATCAGTTTGG - Intronic
1072848987 10:98866185-98866207 TCATCTCTAGAAATTCAATTTGG - Intronic
1072864551 10:99043672-99043694 TCAGCTCTAGAAGTTCAGTTTGG - Intronic
1073899434 10:108203171-108203193 TCATTTCCAGAAGTTCAGTTTGG + Intergenic
1074048685 10:109862856-109862878 TCAGCTCCAGAATTTCATTTTGG - Intergenic
1074178915 10:111039631-111039653 TCAGCTCTAGGATTTCTGTTTGG - Intergenic
1074180759 10:111060623-111060645 TCAGCTCTAGGATTTCTGTTTGG + Intergenic
1074648969 10:115497199-115497221 GCAACTCTATCAGATCAGTTTGG + Intronic
1074691868 10:116013351-116013373 TCATCTCTAGAAGCTTAGTTTGG + Intergenic
1074748846 10:116563729-116563751 TCATCTCTAGAAACTCAGTGTGG - Intronic
1075708190 10:124515325-124515347 TCATCTCTAGAAGCTTGGTTTGG + Intronic
1077640119 11:3873766-3873788 TCAGCTCAGGAGGAGCAGTTAGG - Intronic
1077792822 11:5460426-5460448 TTATTTCTAGAAGTTCAGTTTGG + Intronic
1077841548 11:5981499-5981521 TCAGCTCTATCAAATCAGTTTGG + Intergenic
1077852169 11:6084088-6084110 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
1077984695 11:7340197-7340219 GCAGCTCTATCAGGTCAGTTAGG + Intronic
1078294960 11:10058318-10058340 TCAGCTCTATCAGACCTGTTAGG - Intronic
1078517379 11:12034383-12034405 TCAGCTCTATCAGATCGATTTGG - Intergenic
1078694635 11:13619238-13619260 CCAGCTCTATCAAATCAGTTTGG + Intergenic
1078816203 11:14824445-14824467 TCAGCTCTATCAGATCAGTTAGG - Intronic
1079683759 11:23331042-23331064 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1079742290 11:24077849-24077871 TTAGCTATAAATGATCAGTTTGG + Intergenic
1079747288 11:24149651-24149673 TCAGTTCTAAGAAATCAGTTTGG + Intergenic
1079747989 11:24156717-24156739 TTAACTCTAGAAGATCAGTTTGG - Intergenic
1079814447 11:25038484-25038506 TCAGCTCAAGAAGCTCAGTTTGG + Intronic
1079865441 11:25728362-25728384 TGAGCTCTATAATATCATTTTGG + Intergenic
1079921102 11:26435727-26435749 TCAGCTCTATTAGATCAGTTAGG + Intronic
1080072587 11:28107974-28107996 TCAGGTCTAGAAGACCAGGTGGG - Intronic
1080203561 11:29703898-29703920 ACAGCACTAGAAGATAAGTGTGG - Intergenic
1080422924 11:32127534-32127556 TCAATTCTAGAAATTCAGTTTGG - Intergenic
1080451145 11:32379987-32380009 TCAGCTGTAGAAGTTCAGCAGGG + Intergenic
1080807780 11:35670659-35670681 TCAACTCTAGAATGTCAATTTGG + Intronic
1081293121 11:41350790-41350812 ATAGCTCTAGAAGATTAGTTTGG - Intronic
1081343820 11:41958028-41958050 TCAACTCTCTCAGATCAGTTTGG - Intergenic
1082907836 11:58330876-58330898 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1083371394 11:62185056-62185078 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1084407750 11:68986657-68986679 TCAGCTCTAGAAGTTGCATTTGG + Intergenic
1085731518 11:79002950-79002972 TCAGCTCTATCAGATCAGTTTGG - Intronic
1085931103 11:81085054-81085076 TCAATTCCAGAAGTTCAGTTTGG + Intergenic
1086008411 11:82068525-82068547 TCAGTTCTATCAGATCAGTTTGG + Intergenic
1086303726 11:85458272-85458294 TCAGCTCTATCAAATCTGTTTGG + Intronic
1086343055 11:85866965-85866987 TCAGATCAAGAAGAACACTTGGG + Intronic
1086523227 11:87696350-87696372 TCAGTTCCAGAAGTTCAGCTGGG + Intergenic
1086839622 11:91668330-91668352 TCAGCTCTATTAGATCAGTTAGG - Intergenic
1087791834 11:102414016-102414038 TCAACTCTATCAAATCAGTTAGG - Intronic
1087952154 11:104235916-104235938 TTAGCTCTAGAAGTTTACTTTGG + Intergenic
1088386509 11:109263816-109263838 TCAGCTCTAGAATTTCTGTTGGG + Intergenic
1088507893 11:110543594-110543616 TCAGCTATACCGGATCAGTTTGG - Intergenic
1089191195 11:116654504-116654526 TCAGGGTTAGAAGAGCAGTTGGG - Intergenic
1089342399 11:117767176-117767198 TCAGCTCTTGGAGATAACTTGGG - Intronic
1089625012 11:119745707-119745729 TCAGAGGTAGAAGATCTGTTGGG + Intergenic
1090078174 11:123592519-123592541 GCAGCTCTAGAAGGTCAGTTAGG + Intronic
1092275122 12:7054967-7054989 TCAGCTCTATCAGATCAGTTAGG + Intronic
1092579462 12:9822321-9822343 CCAGCTCTAGCAGATCAGTTAGG - Intergenic
1093239974 12:16658449-16658471 TCAGCTCTATCAGATCAGTTAGG + Intergenic
1093343951 12:18017072-18017094 TCAGCTCTAGAAGATCAGTTTGG - Intergenic
1093477500 12:19572561-19572583 TTGGCTCTATTAGATCAGTTTGG + Intronic
1093490864 12:19702093-19702115 TCAGCTTTATCAGATCAGTTTGG - Intronic
1093497851 12:19778516-19778538 TCAGCTCTATCAGATTACTTTGG + Intergenic
1093528610 12:20135046-20135068 TCAGCTCTATTAGATCAGTTAGG + Intergenic
1093541926 12:20298055-20298077 TCAACTCTATCAGATCAGTTTGG + Intergenic
1093690064 12:22100654-22100676 TCAGCTCTGTCAGATCAGTTAGG + Intronic
1093809649 12:23475541-23475563 TCAGCTCTATGAGATCAGTTAGG - Intergenic
1094798668 12:34003992-34004014 TCAGCTCTAGAAGTTTAGTTAGG - Intergenic
1095111418 12:38298078-38298100 TCAGCTGTAGAAGTTCAGTTAGG - Intergenic
1095458400 12:42414835-42414857 TCATTTCTAGAAGTTCAATTTGG + Intronic
1096925211 12:55136315-55136337 TGAGCTCTATTAGATCAGTTTGG - Intergenic
1097303362 12:58042415-58042437 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1097769664 12:63568314-63568336 TCAGCTCTAGAATTTCCGTGGGG + Intronic
1098145296 12:67490979-67491001 TCAGCTCTATTAGATCAGTTAGG - Intergenic
1098580463 12:72093647-72093669 TCAGCTCTAGAATTTCTGTTTGG + Intronic
1098801630 12:74967121-74967143 TCAGCTCTATCATATCAGTTTGG + Intergenic
1098862857 12:75729411-75729433 TCAGCCCTGTAAGTTCAGTTTGG + Intergenic
1098974994 12:76893226-76893248 TTATCTCTAGAAGTTCAATTTGG - Intergenic
1099146936 12:79058471-79058493 GCAGCTAGAGAATATCAGTTGGG - Intronic
1099353932 12:81610565-81610587 CCAGCTTTAGAAGTTCAGTTTGG + Intronic
1099498129 12:83377997-83378019 TCAGCTCTCTTTGATCAGTTAGG + Intergenic
1100266363 12:92979873-92979895 TCAGCTCTATCAACTCAGTTTGG - Intergenic
1100411132 12:94321206-94321228 TCAGCTCTATCAGATCAGTTAGG + Intronic
1101251519 12:102940482-102940504 TCAGCTCTATTAGATCAGTTTGG - Intronic
1103220207 12:119238068-119238090 TCATCTCTAGAAGTTCAATTGGG + Intergenic
1104686019 12:130784817-130784839 TCAACTCTAGAATTTTAGTTTGG - Intergenic
1105550013 13:21385109-21385131 TCAGCTCTGGAAGTTTGGTTTGG - Intronic
1105880818 13:24605557-24605579 TCAGCTATAGAAGTTCAGCTTGG + Intergenic
1106366815 13:29089779-29089801 TCATTTCTGGAAGTTCAGTTTGG + Intronic
1106443633 13:29802609-29802631 TCACCTCTATCAGATCAGTTTGG - Intronic
1107096166 13:36538903-36538925 TCATCTCTAGAAGTTCCATTTGG + Intergenic
1107225883 13:38046412-38046434 TTAGCTCTATCAGATCAGTTTGG - Intergenic
1107389273 13:39946132-39946154 TCTGATCGAGCAGATCAGTTTGG - Intergenic
1107484761 13:40814801-40814823 TCAGCTATCGAAGTTCAGTTTGG - Intergenic
1107776776 13:43852286-43852308 TCAGCTCTATCAGGTCACTTAGG - Intronic
1108111138 13:47074006-47074028 TCAGCTCTAGAAGATTAGTTTGG - Intergenic
1108502801 13:51083887-51083909 TCAGCTCTTGAAGACCAGCCAGG + Intergenic
1108765777 13:53627670-53627692 TCAGCTTTTGAAGATAATTTTGG + Intergenic
1108839502 13:54594366-54594388 TCAGCTCTATTTAATCAGTTTGG - Intergenic
1109021003 13:57093211-57093233 TCAGCTCCAGAATTTCTGTTTGG + Intergenic
1109040079 13:57322370-57322392 TCACATCTAGAAGCTGAGTTTGG + Intergenic
1110804046 13:79734818-79734840 TCAGCTCTATCAAATCAGTTTGG + Intergenic
1111179053 13:84637498-84637520 TTAGCTCTATGTGATCAGTTTGG - Intergenic
1111338194 13:86848728-86848750 TCAACTCTACCAGGTCAGTTAGG - Intergenic
1113083098 13:106537149-106537171 TCTGCTCTCAAAGATCTGTTTGG - Intergenic
1113227045 13:108170072-108170094 TCAGCTCTATCAAATCTGTTAGG - Intergenic
1114359697 14:21958253-21958275 TCAGCTCTATCAGAACAGTTTGG + Intergenic
1114686629 14:24538081-24538103 TCAGCTCTATCAAATCAGTTTGG - Intergenic
1115868756 14:37777438-37777460 TCAGCTCTATCAGTTCAGTCTGG + Intronic
1116028312 14:39539491-39539513 TCAGCTCTATCAAATCAGTTAGG - Intergenic
1116283913 14:42946930-42946952 TCAGCTCTAGAATTTCAGTTTGG - Intergenic
1117452394 14:55864520-55864542 TTAGCTCTATCAGATCAGTTAGG + Intergenic
1118198528 14:63650573-63650595 TTATCTTTAGAAGAGCAGTTTGG - Intergenic
1118523124 14:66609771-66609793 TCAATTTTAGAAGTTCAGTTCGG + Intronic
1118662244 14:68027675-68027697 TCAGCTCTAGAATTTCAGTTTGG + Intronic
1119610946 14:76061637-76061659 TCAGTTCTAGAAGCTCCATTTGG + Intronic
1120300883 14:82705192-82705214 TCAGCTTTATCAGATCAGTTAGG + Intergenic
1120998954 14:90437567-90437589 TCAGCTCTGAAAGATCAGGCAGG + Intergenic
1121855051 14:97260559-97260581 TCATCTCTAGAAGTTCAGTTTGG - Intergenic
1122101629 14:99415644-99415666 TCAGATTTTGAAGATCATTTTGG + Intronic
1122224334 14:100264936-100264958 CCATCTCTAAAAGCTCAGTTTGG + Intronic
1122253306 14:100456568-100456590 TCATCTCTAGAAGTCCAGTTTGG - Intronic
1123016848 14:105379840-105379862 TCTGCTCTGGGAGATCAGTGTGG - Intronic
1123127156 14:105955063-105955085 TTAGCTCTATCAAATCAGTTTGG - Intergenic
1123455978 15:20426547-20426569 TCAGCTCTAGAATTTAAGTTTGG + Intergenic
1123635592 15:22304290-22304312 TCAGCTCTAGAATTTAAGTTTGG - Intergenic
1124008472 15:25813704-25813726 TCAACTCTAGAAGTTCAATTTGG - Intronic
1124230540 15:27942075-27942097 TCTGCTCTGGAAAAGCAGTTAGG + Intronic
1125274478 15:37976742-37976764 TCAGCTCCATCAGATCAGTTTGG + Intergenic
1126287394 15:47028523-47028545 TCAATTCTAGAAATTCAGTTTGG - Intergenic
1126519864 15:49580789-49580811 TCAGCTCTGTCAGTTCAGTTTGG - Intronic
1126541093 15:49825026-49825048 TCAACTCTGGAAGATGAGCTTGG - Intergenic
1126655385 15:50971773-50971795 TCAGCTCTAGGATTTCTGTTTGG + Intronic
1127049225 15:55063396-55063418 TTATCTCTAGAAGTTCATTTTGG - Intergenic
1127097331 15:55526181-55526203 TCAGCTCTATCAGCTCAGTTTGG + Intergenic
1127153545 15:56104649-56104671 TTAGCTCAAGAAGTTAAGTTGGG + Intronic
1127330943 15:57939794-57939816 TCAGCTCTGTCAGATCTGTTAGG + Intergenic
1128850809 15:70954274-70954296 TCATTTCCAGAAGTTCAGTTTGG + Intronic
1129017466 15:72481157-72481179 ACAGCTCAAGGAGATCAGCTGGG - Intronic
1129559833 15:76554135-76554157 TCAGCTCTATCAGATCAGTTTGG - Intronic
1129583053 15:76832285-76832307 TCATTTCCAGAAGTTCAGTTTGG - Intronic
1130139686 15:81214961-81214983 TCAGCTCTAGAAGTTCAGTTTGG + Intronic
1130174901 15:81558518-81558540 TCAGCTCTAGAAGATCAGTTTGG + Intergenic
1131197137 15:90364624-90364646 TCATATCAGGAAGATCAGTTTGG - Intronic
1131673148 15:94642849-94642871 TCAGCTTTATAAAATGAGTTGGG - Intergenic
1131693595 15:94853326-94853348 TCAGCTCTAGAAGTTCAGTGTGG + Intergenic
1133859025 16:9576633-9576655 TCAGGGCTGGAAGACCAGTTGGG + Intergenic
1134464569 16:14463591-14463613 TCATTTCTAGAAGTTCTGTTTGG - Intronic
1136729918 16:32400724-32400746 TCAGCTCTATCAGTTTAGTTTGG + Intergenic
1137496880 16:48976568-48976590 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1137899315 16:52247302-52247324 TCAGTTCCAGAAGCTCGGTTAGG - Intergenic
1137920697 16:52485699-52485721 TGAGCACTGGCAGATCAGTTAGG + Intronic
1138274202 16:55719582-55719604 TTAGCTCTGGAAGTTCAGTTTGG - Intergenic
1138318754 16:56093018-56093040 TGAGCTCTAGAAGTTCTATTTGG - Intergenic
1138729679 16:59181493-59181515 TCAGTTTTACCAGATCAGTTTGG + Intergenic
1138924549 16:61575521-61575543 TCAGCTCTATTATATCAGTCTGG + Intergenic
1139099262 16:63745431-63745453 TTAGCTCTATCCGATCAGTTTGG - Intergenic
1139946965 16:70648162-70648184 TCTGCTCTTGAAGATCAGTCTGG + Intronic
1140148118 16:72332333-72332355 TCAGTTGTATCAGATCAGTTTGG + Intergenic
1202996475 16_KI270728v1_random:116581-116603 TCAGCTCTATCAGTTTAGTTTGG - Intergenic
1203023162 16_KI270728v1_random:428923-428945 TCAGCTCTATCAGTTTAGTTTGG - Intergenic
1143256777 17:5563430-5563452 CCAGCTCTATCAGATCAGTTTGG - Intronic
1144788332 17:17844130-17844152 GCAGCTCTGGAAGAGCAGTGTGG - Intronic
1148762124 17:50010401-50010423 TCAGCTCTAGAACTTCTATTTGG + Intergenic
1149133499 17:53337043-53337065 TCAGCTCTATCAGTTCAGTTTGG - Intergenic
1149194564 17:54103547-54103569 TCAGCTCTAGAAATTCAGTTTGG - Intergenic
1149247580 17:54728881-54728903 TCAGCTCAATTAGATCAGTTTGG - Intergenic
1149327097 17:55543130-55543152 TCATCTCTAGAAGATTAATTTGG + Intergenic
1149514382 17:57269104-57269126 CCAGGTCTTGAAGATCAGATAGG + Intronic
1150330700 17:64292120-64292142 TCATTTTTAGAAGTTCAGTTTGG - Intergenic
1151163758 17:72187052-72187074 ACAGCTCAAGAAGTTCAGATTGG - Intergenic
1153399560 18:4667952-4667974 TCAGCTCTATCAGGTAAGTTTGG - Intergenic
1153582102 18:6583502-6583524 TCAGCTTTAGAAGTTCAGATTGG - Intronic
1153770442 18:8411261-8411283 TCATCTCTTGAAGTTCAATTTGG - Intergenic
1154321034 18:13352923-13352945 TCAGCTCTAGAATTTCTGTTTGG + Intronic
1154371501 18:13766752-13766774 TCAGCTCTAGCAAATCTGTTTGG - Intergenic
1155043830 18:22086839-22086861 TCATCTCTACAAAATCAGCTGGG + Intergenic
1155255461 18:23994009-23994031 TCAGCTGGAGAAGTTCATTTTGG + Intronic
1155463727 18:26112767-26112789 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1155675945 18:28429075-28429097 TCAGCTCTAGAAACTCAGTTTGG + Intergenic
1155708715 18:28848542-28848564 TCACCTCTATTAGATCCGTTTGG - Intergenic
1155769093 18:29673835-29673857 TCAGGTCTATTAGATAAGTTTGG - Intergenic
1155779457 18:29812411-29812433 TCAGCTCTATCATATCAGATAGG - Intergenic
1156259845 18:35436084-35436106 TCAGCTCTAGAATTTCCATTTGG + Intergenic
1157003770 18:43558413-43558435 TCAGTTCTATCAGATCACTTTGG + Intergenic
1157205279 18:45692594-45692616 TCAGGTCTATCAGATCAGTTTGG - Intergenic
1158337326 18:56427013-56427035 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1158822309 18:61175214-61175236 TCATTTCTAAAAGTTCAGTTTGG - Intergenic
1159088092 18:63817472-63817494 CCAATTCTAGAAGTTCAGTTTGG + Intergenic
1159170460 18:64759416-64759438 TCAGCTCTATACGATCAGTTTGG - Intergenic
1159395323 18:67847816-67847838 TCATCTCTATGAGCTCAGTTTGG - Intergenic
1159404287 18:67979368-67979390 TCATCTATAGTAAATCAGTTTGG + Intergenic
1164495379 19:28755592-28755614 TCAGCTCCATTAGATCAGTTTGG - Intergenic
1164496324 19:28766880-28766902 TCAGCTCTATTAGCTCAGTTTGG - Intergenic
1164499166 19:28799259-28799281 TCACCTCAAGAAGTTCAGTTTGG - Intergenic
1166031137 19:40129775-40129797 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
1167772018 19:51526851-51526873 TCAGCTCTATCAGCTCAGTTTGG - Intronic
1168131657 19:54324855-54324877 TCAGCTCGAGAAGTTCAGTTTGG + Intergenic
1168209526 19:54880390-54880412 TCAGCTCCATCAGATCCGTTTGG + Intronic
925079081 2:1047186-1047208 TCAGCTCTATCAGATCAGTTTGG + Intronic
925162642 2:1696463-1696485 TCAGTTCTAGAATTTCAGTTTGG - Intronic
925647080 2:6046231-6046253 TCAGCTCTATCAGATTAGTTAGG - Intergenic
926479894 2:13378622-13378644 TCACCTCTAGAATTTAAGTTTGG - Intergenic
927332090 2:21877665-21877687 TCAGCTTTATTAGATCAGTTTGG + Intergenic
927565225 2:24105767-24105789 TCAGCTGTATCAGATCAGTTGGG - Intronic
927622501 2:24676782-24676804 TCAGTTTTATCAGATCAGTTTGG - Intronic
928609190 2:32975738-32975760 TTAGCTCTATCAGATGAGTTTGG + Intronic
928822263 2:35375526-35375548 TCATCACTAGAAGTTCAATTTGG - Intergenic
930304699 2:49664276-49664298 TCAGATTTATCAGATCAGTTAGG + Intergenic
930897804 2:56465460-56465482 TCAATTCCAGAAGTTCAGTTTGG - Intergenic
930916901 2:56703121-56703143 TCAGCACTAGAGGATGAGATTGG + Intergenic
931501701 2:62875787-62875809 TCAGCTCTATCAGATAATTTTGG - Intronic
931557412 2:63520037-63520059 TCAGCTCTGTCAGATCAGTTTGG - Intronic
932424918 2:71624200-71624222 GCAGCTCCAGAAGATGAGCTGGG - Intronic
932853442 2:75209965-75209987 TCAGTTCTATCAGATCAGTTTGG + Intergenic
933173647 2:79153948-79153970 TCACCTCTATCAGATCAGTTTGG + Intergenic
933181697 2:79234868-79234890 TCAGCTCCAGAAGTTCAGGTTGG + Intronic
933327902 2:80862439-80862461 TCAATTCCAGAAGTTCAGTTTGG + Intergenic
933362859 2:81309983-81310005 TTAGCTCTATCAGATCAGTTTGG - Intergenic
933501892 2:83123369-83123391 TCAGGTCTAGAAGATGAATCAGG + Intergenic
933604043 2:84362083-84362105 TCAGCTCTATCAGATCAGTTAGG - Intergenic
933857010 2:86424610-86424632 TCATCTCTAGAAGTACGGTTGGG - Intergenic
934186226 2:89678777-89678799 TCAGCTCTATCAGTTTAGTTTGG + Intergenic
934873085 2:97886093-97886115 TCAGCTCTAGGATTTCTGTTTGG + Intronic
934912126 2:98268497-98268519 TCAGCTCTAGAATTTCTATTTGG + Intronic
935020441 2:99225260-99225282 TAAATTCTAGAAGTTCAGTTTGG - Intronic
935323629 2:101913511-101913533 TCATCTCTTGAAGAACATTTGGG + Intergenic
935975230 2:108571888-108571910 TGAGCTCTGGAAGAGCAGCTGGG - Intronic
936488911 2:112953164-112953186 TCAACTCTAAAAGTTCATTTTGG + Intergenic
937484601 2:122301417-122301439 CCAGCTCTGTCAGATCAGTTTGG - Intergenic
937608599 2:123832896-123832918 TCAGCTCCAAAATATCTGTTTGG + Intergenic
937777400 2:125794880-125794902 TCAGCTCTAGAATTTCTCTTTGG - Intergenic
937830718 2:126419667-126419689 TCAGCTCTAGAATTTCTATTTGG + Intergenic
938209379 2:129454328-129454350 TCAGCTCTTGAAGAGCATTTGGG - Intergenic
938264677 2:129918754-129918776 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
938868680 2:135451839-135451861 TCACCTCTAGAAGTTTAGTTTGG - Intronic
939453504 2:142402116-142402138 TCAGCTTTAGAATTTCTGTTTGG - Intergenic
939735659 2:145841324-145841346 GGAGTTATAGAAGATCAGTTGGG - Intergenic
939945344 2:148403081-148403103 TTATCTCTAGAAGTTCAATTTGG + Intronic
939946322 2:148415800-148415822 TCAACTCTATCAGATCAGTTTGG + Intronic
940629198 2:156216322-156216344 TCAGCTCTATTGAATCAGTTTGG - Intergenic
940923717 2:159340079-159340101 TTAGCTCTAGAACTTCTGTTTGG - Intronic
941566515 2:167115193-167115215 TCAGCTCTATCAGATCCGTTTGG + Intronic
941590107 2:167409591-167409613 TCAGCTCCATCAGGTCAGTTAGG + Intergenic
941681097 2:168400636-168400658 TCATGTCCAGAAGTTCAGTTTGG + Intergenic
942384362 2:175425662-175425684 TCATCTCTGGAAGTTCAGTTTGG - Intergenic
943391753 2:187278454-187278476 TCAACTCGATCAGATCAGTTTGG + Intergenic
943425354 2:187725080-187725102 TAAGCTCTATCAGATCAGTTTGG + Intergenic
944436666 2:199696960-199696982 TCAGCTGTATCAGATTAGTTTGG - Intergenic
944471429 2:200056916-200056938 CCAGCTCTATCAGATCAGTTTGG - Intergenic
944624841 2:201560088-201560110 TCAGCTCTAGAATGTCCGTTTGG - Intronic
945357304 2:208855777-208855799 TCAGCTCTATCAGGTCAGTTTGG + Intergenic
945430378 2:209756342-209756364 TCAGCTCTATCAGATCAGTTTGG - Intergenic
945461432 2:210113750-210113772 TCAGCTCTAGAATTTCTGTTTGG - Intronic
945487603 2:210416250-210416272 TCAGCTCTATCAGCTTAGTTGGG + Intergenic
945658758 2:212658751-212658773 TCAATTCCAGAAGTTCAGTTTGG + Intergenic
945758791 2:213884827-213884849 TCAGCTTTAGAAGTTCAGTTTGG + Intronic
945909649 2:215634446-215634468 TCAGCTCTATCACTTCAGTTTGG + Intergenic
946048491 2:216841242-216841264 TCAGCTTGAGATGATGAGTTGGG - Intergenic
946262153 2:218502287-218502309 TCATCTCTAGAAGTTTAATTTGG - Intronic
946726462 2:222666333-222666355 TCACAGCAAGAAGATCAGTTAGG + Intergenic
947322258 2:228933592-228933614 TCAGCTCTAGAATTTCTATTTGG - Intronic
948731820 2:239969295-239969317 TTAGCTCTAGAAATTCTGTTTGG - Intronic
1168733163 20:104636-104658 TCAGTTCTAGAAGTTTAGTTTGG - Intergenic
1168812536 20:714693-714715 TCATTTCTAGAAGTTCAGTTTGG + Intergenic
1169159418 20:3363948-3363970 TCATCTCTAGAAGTTGATTTGGG + Intronic
1169217831 20:3803652-3803674 TCAGCTCTAGGCCATCAGATGGG - Intronic
1169500577 20:6156993-6157015 TCAATTCCAGAAGTTCAGTTTGG + Intergenic
1170378597 20:15731011-15731033 TCAGCTCTATCAGATCAGTTTGG + Intronic
1173483097 20:43418698-43418720 TCAGCTGTAGAATATCTGTTAGG - Intergenic
1174187943 20:48720236-48720258 TCAGGTTCAGAAGATCAGTAAGG - Intronic
1176899138 21:14418289-14418311 TCAGCTCTAGAATTTCTGTTTGG - Intergenic
1177120736 21:17133858-17133880 TCAATTCCAGAAGTTCAGTTTGG - Intergenic
1177133923 21:17290589-17290611 TCAGCTCTGTCAGATCAGTGTGG - Intergenic
1177280225 21:18972619-18972641 TCAGCTCTAATAGCTCAGCTGGG - Intergenic
1177320592 21:19514525-19514547 TCAGCTCTGTAAGATCAGTTTGG - Intergenic
1180542546 22:16464324-16464346 TCAGCTCTATCAGTTTAGTTTGG - Intergenic
1180762073 22:18218303-18218325 TCAGTTCTAGAATTTCTGTTTGG - Intergenic
1180773594 22:18406305-18406327 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1180804943 22:18655855-18655877 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1180805800 22:18713556-18713578 TCAGTTCTAGAATTTCTGTTTGG - Intergenic
1181069654 22:20325021-20325043 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1181144181 22:20832436-20832458 TCAGCTCCATCAGCTCAGTTTGG + Intronic
1181192693 22:21153239-21153261 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1181216749 22:21339337-21339359 TCAGTTCTAGAATTTCTGTTTGG - Intergenic
1181426445 22:22844790-22844812 TCAGTTCTAGAAAATCTGCTTGG - Intronic
1182466548 22:30520419-30520441 TCTGCTCTGGAAGAACAGATGGG - Intergenic
1183274191 22:36881591-36881613 TCAACTCTAGAATTTCAATTTGG - Intergenic
1184052103 22:42014782-42014804 TCAACTCTAGAATTTCTGTTTGG + Intronic
1184896719 22:47411847-47411869 TCATCTCTAGATGTTCAATTTGG - Intergenic
1203235424 22_KI270731v1_random:147287-147309 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
949145271 3:691917-691939 TTAGCTCTAGAAGTTCAGTTTGG - Intergenic
950600865 3:14034530-14034552 TCAGCTCTATCAGATCAGTTAGG + Intronic
951180846 3:19656378-19656400 TCAGCTCTAGGATTTCTGTTTGG - Intergenic
951297083 3:20950927-20950949 TCAGCTCTATCAGATTAGTTAGG + Intergenic
951309326 3:21105313-21105335 TCAGCCTTATCAGATCAGTTTGG + Intergenic
951788055 3:26445326-26445348 CCATCTCAAGAAGCTCAGTTTGG + Intergenic
951905810 3:27706271-27706293 TTATCTCTAGAAGTTCAATTTGG + Intergenic
952117336 3:30198527-30198549 TCAGTTCCAGAAAATCAGCTTGG - Intergenic
952694176 3:36246787-36246809 TCAGCTCTAGAAAGTGAATTTGG - Intergenic
953079917 3:39607482-39607504 TCTGCTCTGTTAGATCAGTTTGG + Intergenic
953081744 3:39626327-39626349 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
953104399 3:39861647-39861669 TCAGCTCTATCAGATCAGTTTGG - Intronic
953296705 3:41725535-41725557 TCAGTTCTAGAATATCCATTTGG + Intronic
953501361 3:43438105-43438127 TCAGCTCCAGAATTTCTGTTGGG - Intronic
954561393 3:51559680-51559702 TCATCTCTAGAACAGCAGCTGGG - Intronic
955168682 3:56541359-56541381 TCATCTTTAGAAGTTCAATTTGG + Intergenic
955865081 3:63373382-63373404 TCAGCTGTATCAGATCAGTTTGG - Intronic
956378689 3:68643698-68643720 TTAGCTCTATCAGATCAGTTTGG + Intergenic
956546140 3:70405515-70405537 TCATCTCTAGAAGTTCCATTTGG - Intergenic
957014004 3:75042572-75042594 TCAATTCTAGTAGTTCAGTTTGG + Intergenic
957027134 3:75194675-75194697 TCATTTCTAGAAGTTCATTTTGG - Intergenic
957152268 3:76500728-76500750 TCAGTTCTAGAAGATAAAGTTGG + Intronic
957254903 3:77824678-77824700 TCAGCTCAAGAAGTTTAGTTTGG + Intergenic
957592877 3:82224073-82224095 TTAACTCTAGAAGTTCAGTTTGG + Intergenic
957899254 3:86467224-86467246 TCAGCTCTAGAATTTCCATTTGG - Intergenic
958064624 3:88527877-88527899 TCAGCTGTATCAGATCAGTTTGG + Intergenic
958148366 3:89657244-89657266 TCAGCTGTATCAGATCAGTTAGG + Intergenic
958460167 3:94384354-94384376 TCAGTTTCAGAAGATCAGTTTGG - Intergenic
958462788 3:94419604-94419626 TCAGCTCTATCAGTTCAGTTTGG - Intergenic
958763004 3:98330195-98330217 TCAGCTCCAGAAGTTTACTTTGG - Intergenic
958806365 3:98815718-98815740 TTATCTCTAGATGTTCAGTTTGG - Intronic
958838518 3:99173679-99173701 CCAGCTCTATTAGATCAGTTTGG - Intergenic
958982077 3:100733399-100733421 TCAGCTCTAGAATTTCCATTGGG + Intronic
959354257 3:105305320-105305342 TCAGCTCTATAATTTCTGTTTGG - Intergenic
959439293 3:106357467-106357489 TCAGCTTTTGTAGGTCAGTTTGG + Intergenic
959506364 3:107160935-107160957 TTAGCTATAGAAGATCTTTTTGG - Intergenic
959825447 3:110789685-110789707 TCAGCTCCATCAGATCAGTTTGG + Intergenic
959879305 3:111424518-111424540 TCAGCTCTCTAAAATAAGTTTGG - Intronic
959952180 3:112192690-112192712 TCAGCTCTAGAATTTCTGTCTGG + Intronic
960015564 3:112884375-112884397 TCAGCACTATCAGATCAGTTTGG + Intergenic
960561233 3:119085697-119085719 TCAGCTCAAGAAGTTCAGTTTGG - Intronic
960579383 3:119261973-119261995 TCATCTCTACAAGTTCAATTTGG - Intergenic
960581903 3:119288178-119288200 CCAGCTCTAGAATTTCTGTTTGG + Intergenic
960754844 3:121000447-121000469 TCATGTCTATCAGATCAGTTAGG + Intronic
961932955 3:130553485-130553507 TCAGCTCTATCAGATCAGTTTGG + Intergenic
961983111 3:131103003-131103025 TCAGCTCTAGAAGCTCAATTTGG + Intronic
962001584 3:131304245-131304267 TCAGCTCTATCAGATCAGTTTGG + Intronic
962506004 3:136046900-136046922 TCAATTCTAGAAGTTCAGTTTGG - Intronic
962831983 3:139150889-139150911 TCAGGTCTATCAGATCAGTTTGG - Intronic
962993982 3:140606483-140606505 TCAGCTCTATCAGATCAATTTGG - Intergenic
963368756 3:144370233-144370255 TCATTTCAAGAAGGTCAGTTAGG - Intergenic
963876773 3:150484537-150484559 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
964486258 3:157187714-157187736 TCAGCTCCATCAGATCAGTATGG - Intergenic
964816349 3:160721010-160721032 TCAGTTCAAGAAGTTCAGTTTGG - Intergenic
965009235 3:163064272-163064294 TCAGTTCTATTAGTTCAGTTAGG - Intergenic
965340554 3:167485567-167485589 TAAGTTCTAGAAGTTCATTTGGG - Intronic
965519010 3:169654417-169654439 TCAGGTCTTAAAAATCAGTTGGG + Intronic
965810874 3:172590829-172590851 TCAGCTCTATCAGATCAGTTAGG + Intergenic
966964835 3:184980656-184980678 TCAGCTCTAACAGATCAGTTTGG + Intronic
968552863 4:1232979-1233001 TCAGGTCTAGAAGATCCAGTTGG - Intronic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
969837233 4:9851726-9851748 TCAGCTCTATCAGATAAGTTTGG - Intronic
970068865 4:12131065-12131087 TCAGCCCTAGAACTTCTGTTTGG - Intergenic
970633975 4:17986594-17986616 TCTGCTCTATCAGATCAGTTAGG + Intronic
971096275 4:23408231-23408253 TCAATTCTAGAAGTTCAGTTTGG + Intergenic
971313948 4:25551464-25551486 CCAGCTCTAGAAAATCATATGGG + Intergenic
971709224 4:30090076-30090098 TCAGCTCTATCAGTTCAGTTTGG + Intergenic
971841358 4:31856315-31856337 TCAGTTTCAGAAGTTCAGTTTGG - Intergenic
972105839 4:35485845-35485867 TTAGCTCCAGAAGATTAATTTGG - Intergenic
972215193 4:36890318-36890340 TCAGCTCTATCAGATTAGTTTGG + Intergenic
973034532 4:45389926-45389948 TCAGCTCTAGAAGGTTAGTTTGG + Intergenic
973129670 4:46635323-46635345 TCAGCTCTATCAGACCAGTTTGG + Intergenic
973346198 4:49059278-49059300 TTAGCTCTAGAATTTCTGTTTGG + Intronic
974342928 4:60637624-60637646 TTAATTCTAGAAGTTCAGTTTGG + Intergenic
974495453 4:62620478-62620500 TCAACTCTTGAAGATCATATTGG - Intergenic
974522677 4:63004918-63004940 TCATTTCTAAAAGATCATTTTGG - Intergenic
974599543 4:64059551-64059573 TTAGCTCTAGAAGTTTAGTTTGG + Intergenic
974625515 4:64422601-64422623 TCAGGGCGATAAGATCAGTTTGG - Intergenic
974914287 4:68160810-68160832 TCACTTCCAGAAGTTCAGTTGGG + Intergenic
975275428 4:72494396-72494418 TCAGCTCCAGAATTTCTGTTTGG + Intronic
975723495 4:77270362-77270384 TCAGCTCTAAAAGGTCATCTAGG - Intronic
975897012 4:79105647-79105669 TCAGCTTTATCAGATCAGTTTGG + Intergenic
975922523 4:79409075-79409097 TCATCCCTAGAAGCTCAATTTGG + Intergenic
976481718 4:85554622-85554644 TCAGCTCTATCAGATCAGTTTGG + Intronic
976487931 4:85630171-85630193 TCAGCTATAGAATATCTGGTTGG + Intronic
976492876 4:85692654-85692676 TCAGCTCCAGAAGTTCAGTTTGG + Intronic
977195429 4:94053165-94053187 TCATTTCTAGAAGTTCAGTTTGG - Intergenic
977385154 4:96329568-96329590 TCAGCTCTATCAGAACAGCTTGG - Intergenic
977482367 4:97594304-97594326 TCAGCTCTATCAGATCAGTTTGG - Intronic
977652218 4:99484044-99484066 TCAGCTGTATCAGATCAGTTTGG + Intergenic
977948037 4:102936559-102936581 TCAGCTCTATCAGTTTAGTTTGG - Intronic
977953872 4:103004240-103004262 TTAGTTCTATCAGATCAGTTTGG - Intronic
977997594 4:103514171-103514193 TCATCTCTAGAAGGTCAGTTTGG + Intergenic
978271444 4:106894649-106894671 TCAGCTCTATTAGATCATTTTGG - Intergenic
978940756 4:114433854-114433876 TCAGCTCTATCAGTTCAGTTTGG + Intergenic
979208892 4:118076631-118076653 TCAGCTCTATCAGATCAGTTTGG + Intronic
979758577 4:124372759-124372781 TCAGCTCTATCAGCTCAGTTTGG + Intergenic
979985841 4:127313503-127313525 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
980091242 4:128445276-128445298 TCAGATCTATCAGATCAGTTTGG + Intergenic
980532071 4:134069656-134069678 TCAACTCTATCAAATCAGTTTGG + Intergenic
980685196 4:136219018-136219040 TCAGCTCAATCAGATCAATTTGG + Intergenic
980694617 4:136338547-136338569 TCAGCTCTATCAGCTCAGTTAGG - Intergenic
980731610 4:136831827-136831849 ACAGCTCTTGAAGATCCGGTGGG + Intergenic
981280093 4:142947112-142947134 TCAATTCCAGAAGTTCAGTTTGG - Intergenic
981388852 4:144163878-144163900 TCAGCTCTATCAGATGTGTTAGG + Intergenic
981466353 4:145076762-145076784 TCAGCTCTACCAGGTCAGTTTGG - Intronic
982319765 4:154066091-154066113 TCAGCTCTAGGATTTCTGTTTGG + Intergenic
982931154 4:161408731-161408753 TTAGCTCAAGAAGCTCAGTTTGG - Intronic
983110842 4:163747637-163747659 TTAGCTCTAGAAGTTCAATTTGG - Intronic
983431508 4:167656924-167656946 TCAGCTCTGTGAGATCTGTTAGG - Intergenic
983487728 4:168351611-168351633 TCAGCTCTTTCAGTTCAGTTCGG + Intergenic
983487799 4:168352547-168352569 TCAGCTCTATCAATTCAGTTTGG + Intergenic
983547880 4:168981433-168981455 TCAGGTCTATCAGCTCAGTTTGG - Intronic
984004475 4:174292692-174292714 TCAGCTCTAGGATTTCTGTTTGG + Intronic
984067276 4:175063406-175063428 ACAGCTTAAGAAGTTCAGTTTGG - Intergenic
984236150 4:177160823-177160845 TCAGCTCTATCAGATCAGTTTGG - Intergenic
985365880 4:189232299-189232321 TTAGTTCCAGAAGGTCAGTTTGG + Intergenic
985876719 5:2604771-2604793 TCAGCTTTACAAAATAAGTTGGG + Intergenic
985901169 5:2795112-2795134 TTACCTCTAGAAGATCTATTTGG + Intergenic
986620516 5:9668074-9668096 TCAACTCTATCAGATCAGTTTGG - Intronic
986846124 5:11755770-11755792 TCAGCTCTACCAGGTCAGTTTGG + Intronic
986909183 5:12533243-12533265 TCAGCTCTAGAGGATTACTTTGG - Intergenic
987159857 5:15131391-15131413 TTAGCTCTATCAGATGAGTTTGG + Intergenic
987649154 5:20718450-20718472 TGAGCTCTAGAAGTTCAGTGTGG + Intergenic
987977414 5:25032588-25032610 TCAGCTCTAGAAAATAAGTCTGG + Intergenic
988034365 5:25807048-25807070 TCTGCTCTAGAAGATCAGTTTGG + Intergenic
988165893 5:27589730-27589752 TCAGGTCTAGAAATTCAGTTTGG + Intergenic
988238503 5:28576679-28576701 TCAGCTCAAGAATTTCAGTTTGG - Intergenic
988324075 5:29738796-29738818 TCAGCTCTATCATATAAGTTTGG - Intergenic
988645575 5:33092081-33092103 TCATCTCTATCAGGTCAGTTTGG + Intergenic
988675285 5:33427177-33427199 TCAGCTCTATCAGATCAGTTTGG + Intergenic
988746404 5:34143089-34143111 TGAGCTCTAGAAGTTCAGTGTGG - Intergenic
988754991 5:34238437-34238459 TCTGCTCTAGAAATTCAGTGTGG - Intergenic
989779402 5:45246425-45246447 TCAGCTGTATCATATCAGTTTGG + Intergenic
990792158 5:59494378-59494400 TCAGCTCCTGAACATCTGTTAGG + Intronic
991244137 5:64490801-64490823 TCAGCTCTATCAGATCAGTTTGG - Intergenic
991281733 5:64922466-64922488 TCATATCCAGAAGTTCAGTTTGG + Intronic
991527178 5:67573656-67573678 TCAGCTCCAGAATTTCTGTTTGG + Intergenic
991743203 5:69704121-69704143 TCTGCTCTAGAAATTCAGTGTGG - Intergenic
991754492 5:69851082-69851104 TCTGCTCTAGAAATTCAGTGTGG + Intergenic
991794776 5:70283857-70283879 TCTGCTCTAGAAATTCAGTGTGG - Intergenic
991804111 5:70407832-70407854 TCTGCTCTAGAAATTCAGTGTGG + Intergenic
991822591 5:70579432-70579454 TCTGCTCTAGAAATTCAGTGTGG - Intergenic
991833821 5:70726230-70726252 TCTGCTCTAGAAATTCAGTGTGG + Intergenic
991887154 5:71283395-71283417 TCTGCTCTAGAAATTCAGTGTGG - Intergenic
992029423 5:72706756-72706778 TAATCTCTAGAAGTTCAATTTGG + Intergenic
992314162 5:75535789-75535811 TCATCTCTATCAGATGAGTTTGG + Intronic
992965716 5:81997690-81997712 TTAGCTCTATCAGATCAGTTTGG - Intronic
993150053 5:84149775-84149797 TCATCTCTGGAAGTTCAATTAGG - Intronic
993366810 5:87043719-87043741 TCATCTCTAGAAGTTCTATTTGG + Intergenic
993944594 5:94102330-94102352 TCATCTCTATCAGATCAGTTTGG - Intronic
994060820 5:95474944-95474966 TCAGCTCTGGAAGTTCAGTTTGG + Intronic
994558258 5:101331838-101331860 TCAGCTCTGTCAGATTAGTTTGG - Intergenic
994573088 5:101538389-101538411 TCAGCTCTGTCAGATCAGTTTGG - Intergenic
994603791 5:101941961-101941983 TCAGCTCAAGAAGCTCAGTTTGG + Intergenic
994613931 5:102079382-102079404 TCAGCTTTATCAGATCCGTTTGG - Intergenic
994635034 5:102334239-102334261 TCAGCTCTAGAATTTCTTTTTGG - Intergenic
994907720 5:105862350-105862372 TCAGCTCTATCAGATCAGTTTGG - Intergenic
995219794 5:109634989-109635011 TTAGCTCTATCAGATTAGTTAGG - Intergenic
995488138 5:112659625-112659647 TCAGTTCTATCAGATCCGTTTGG - Intergenic
995978092 5:118066751-118066773 TCAGCTCTAGAAGTTCAATATGG + Intergenic
995995273 5:118291084-118291106 TCAGCTCTATCAGATCAGTTTGG + Intergenic
996142036 5:119923413-119923435 TCAGCTTGATCAGATCAGTTTGG + Intergenic
996245746 5:121262419-121262441 TTGGCTCTATCAGATCAGTTTGG + Intergenic
996249880 5:121316753-121316775 TCAGCTCTATCAGATCACTTTGG + Intergenic
996469003 5:123837506-123837528 TCAGCTCTATCAGATTACTTTGG - Intergenic
996898040 5:128509411-128509433 TCATCTGTAGAAGTTCAATTTGG + Intronic
997021617 5:130008767-130008789 TCACCTCTATTAGATCAGTTTGG - Intronic
998776429 5:145609098-145609120 TCAGCTCTATCAGTTCATTTTGG + Intronic
999007506 5:147998689-147998711 TCAGCTATAGAAGAGGAATTAGG - Intergenic
1000521387 5:162299252-162299274 TCAGCTCTATCAGATCATTTTGG + Intergenic
1001851314 5:174969289-174969311 TCAGCTCTAACAGATCAGTCTGG + Intergenic
1002386831 5:178874573-178874595 TGAGCTCTATTAGATCAGTTTGG + Intronic
1003437495 6:6105489-6105511 TCAGCTCTATTAGATCAATTAGG + Intergenic
1003470362 6:6424141-6424163 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
1004212419 6:13662798-13662820 TCAGCTCCAGAATTTCTGTTTGG - Intronic
1004793273 6:19052198-19052220 TCAGCTCTAGAAGTTTAGTTTGG - Intergenic
1005544552 6:26851327-26851349 TGAGCTCTAGAATTTCAGTGTGG - Intergenic
1005553612 6:26950148-26950170 TCTGCTCTAGAAATTCAGTGTGG - Intergenic
1005800016 6:29411081-29411103 TCAGCTCTATCAGGTCAGTTAGG - Intronic
1006287790 6:33111047-33111069 AAAGCTCTAGAAGATCACATTGG - Intergenic
1006963134 6:37954495-37954517 CCATCTCTAGAAGGCCAGTTGGG + Intronic
1007561506 6:42812584-42812606 TCATCTCCAGAAGTTCAATTTGG - Intronic
1008315289 6:50031592-50031614 TCAGCTGAAGAAGTTCAGTTTGG - Intergenic
1008336952 6:50318071-50318093 TCATCGCTAGGAGTTCAGTTTGG - Intergenic
1008716320 6:54294438-54294460 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1009045788 6:58236523-58236545 TCAGCTCAAGAATTTCATTTTGG + Intergenic
1009221602 6:60990836-60990858 TCAGCTCAAGAAGTTCATTTTGG + Intergenic
1009248065 6:61264298-61264320 TCAGCTCTATCAGATGAGTTTGG + Intergenic
1009325203 6:62340082-62340104 TTAGCTCTGGAAGATCAGCTTGG - Intergenic
1009889020 6:69657568-69657590 TCAGCTCTGTCAGAACAGTTAGG - Intergenic
1009946321 6:70346017-70346039 TCAGCTCTATCTGATCAATTTGG + Intergenic
1009998289 6:70921440-70921462 TCAGCTCTATCAGTTCAGTTTGG + Intronic
1010272253 6:73927771-73927793 TCAGCTCAATCAGATAAGTTTGG - Intergenic
1010295644 6:74193526-74193548 TCACCTCTATTAGACCAGTTAGG + Intergenic
1010495623 6:76531548-76531570 TCAGATCTATCAGGTCAGTTTGG + Intergenic
1010782961 6:79966339-79966361 TCAGCTCTATTGGATCAATTAGG - Intergenic
1010878592 6:81139457-81139479 TCAGCTCTATCAGTTCAGTCTGG - Intergenic
1011320541 6:86087596-86087618 TCAGCTCCAGAAGATCAGTCTGG + Intergenic
1011785103 6:90835028-90835050 TCACTTCCAGAAGATCAGTATGG - Intergenic
1011886929 6:92108502-92108524 TCAGTTCCAGAAATTCAGTTCGG + Intergenic
1012521894 6:100131397-100131419 TCAGCTCTAGAATTTCTATTTGG + Intergenic
1013757103 6:113475108-113475130 TTAGCTCTAGAATATCTATTTGG + Intergenic
1014045741 6:116883857-116883879 TCAACTTTAAAAGGTCAGTTTGG - Intronic
1014124531 6:117760906-117760928 TCAGCTCTGTCAGATCTGTTAGG - Intergenic
1014132258 6:117847501-117847523 TCAGCTCTATCATATCAGCTTGG - Intergenic
1014520651 6:122438593-122438615 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1014566382 6:122954380-122954402 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1014928552 6:127304716-127304738 TCAGCTCTAGAATTTCTGCTTGG - Intronic
1015488501 6:133799311-133799333 TCAGCTCTATCAGATCAGTTAGG + Intergenic
1016075189 6:139787699-139787721 TCAGCTCTGTAAGATCAGTTTGG + Intergenic
1016139240 6:140587146-140587168 TCATTTCTACAAGTTCAGTTTGG - Intergenic
1016374755 6:143409146-143409168 TCAGCTCTAGAATATTCTTTAGG - Intergenic
1016663632 6:146610176-146610198 TCAGCTCTATCAGATGAGTTTGG + Intronic
1017150446 6:151274384-151274406 TCAGTTCTTGAAGATCACCTGGG + Intronic
1017352410 6:153458285-153458307 TCAGCTCAAGAAGTTTAATTTGG + Intergenic
1017994388 6:159519904-159519926 TCAGCTCTATCAGAGCAGTTAGG + Intergenic
1018124828 6:160671652-160671674 TCAGCTCTGTCAGATCCGTTAGG - Intergenic
1018145079 6:160878181-160878203 TCAGCTCAAGAAGTTCAGTTTGG - Intergenic
1020544638 7:9510472-9510494 TCAGTTCTAGATGTTCAATTTGG - Intergenic
1020549791 7:9588810-9588832 TCACTTCTATAAGGTCAGTTTGG - Intergenic
1020607700 7:10359397-10359419 TCAGCTCCATCAGATCAGCTTGG + Intergenic
1021123897 7:16827586-16827608 TCAGCTCCAGAATTTCTGTTTGG - Intronic
1021326672 7:19279306-19279328 TTAGCTCCAGAATATCTGTTTGG + Intergenic
1021366366 7:19784364-19784386 CCAGCTTTATCAGATCAGTTTGG - Intergenic
1021834682 7:24658250-24658272 TCATTTCTAGAAGTTCAGATTGG + Intronic
1022273633 7:28834720-28834742 TCAGCTATATCAGATCAGTTTGG - Intergenic
1022549519 7:31225807-31225829 TCAGTTCTAGAATTTCTGTTTGG + Intergenic
1022928938 7:35089410-35089432 TCAGCTCTAGAATTTCCGTGGGG + Intergenic
1023075837 7:36482188-36482210 TCAGCTCTATCAGTTCAGTTTGG + Intergenic
1023785552 7:43704649-43704671 TCATTTCTGGAAGTTCAGTTTGG + Intronic
1024413370 7:49074163-49074185 TGAGCTCTAGAACATCAGATAGG - Intergenic
1024645987 7:51370738-51370760 TCAGTTTCAGAAGTTCAGTTTGG - Intergenic
1024811191 7:53214194-53214216 TCAGCTCTATAATTTCTGTTTGG - Intergenic
1024941770 7:54770141-54770163 TCAGCTCTAGAAGTTCTGTTTGG - Intergenic
1026063924 7:67052481-67052503 TCATTTCTAGAAGTTCAGTTTGG + Intronic
1026714429 7:72774978-72775000 TCATTTCTAGAAGTTCAGTTTGG - Intronic
1026925388 7:74188768-74188790 GCAGCTCTAGAAGATGAGATTGG + Intronic
1027956616 7:84887018-84887040 TCAGCTCTATCAGATCAGTTAGG + Intergenic
1028019448 7:85751344-85751366 TCAGCTCTATTAGATCAATTTGG - Intergenic
1028053970 7:86220938-86220960 CCAGTTCTATCAGATCAGTTTGG - Intergenic
1028347144 7:89797468-89797490 TCATTTCTATCAGATCAGTTTGG + Intergenic
1028353298 7:89876724-89876746 TCAGCCCTATCAGATCAGTTTGG + Intergenic
1029976216 7:104836703-104836725 TCAGCTCTGGAATATCAGAATGG - Intronic
1030129590 7:106187135-106187157 TCATCTCTGGAAGTTCAATTTGG + Intergenic
1030172190 7:106614512-106614534 TCATCTCTAGAAGTTTATTTTGG + Intergenic
1030374842 7:108743653-108743675 TCAGCTCTATCAGATCAGTTAGG + Intergenic
1030625115 7:111836695-111836717 TCATCTCTAGAAGTTTAATTTGG - Intronic
1030625925 7:111846148-111846170 TCAGCTTCTGAAGATCAGTGAGG - Intronic
1030710008 7:112738954-112738976 TCAGCTCTAGGATTTCTGTTTGG + Intergenic
1031039623 7:116825925-116825947 TCAGCTCTATTAGATCTGTTAGG + Intronic
1032775505 7:135109023-135109045 ATAGCTCTATAAGATCAGTTAGG + Intronic
1033528006 7:142235387-142235409 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1033831654 7:145261947-145261969 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1036613368 8:10368911-10368933 TAAGCTCTTGGAGATCAGTAGGG - Intronic
1038170519 8:25127597-25127619 TCAGCTCTAGAATATCTGTTTGG - Intergenic
1038354853 8:26818608-26818630 TCAGCTCCAGAATTTCTGTTTGG - Intronic
1039016269 8:33152938-33152960 TCAGGCCAAGAAGATGAGTTAGG - Intergenic
1039102553 8:33956884-33956906 TAAGCTCTATCAGATTAGTTAGG + Intergenic
1039889917 8:41678663-41678685 TCATCTCTAGAAGATTGGCTTGG + Intronic
1040881758 8:52212777-52212799 TCATTTCTAGAAGAACATTTTGG + Intronic
1040924680 8:52666700-52666722 TCAGCTCTACAGTTTCAGTTTGG - Intronic
1040944074 8:52863871-52863893 TCAGCTATATCAGATCATTTTGG + Intergenic
1040962628 8:53051182-53051204 TCAGCTCTTTTAGATCAGTCTGG + Intergenic
1041592982 8:59611561-59611583 TGAAATCTAGAAGAGCAGTTAGG - Intergenic
1041622474 8:59989357-59989379 TCAGCTGTAGAATTTCTGTTTGG + Intergenic
1042974556 8:74452602-74452624 TTAGCTCTAGAATTTCAATTTGG + Intronic
1043307621 8:78817087-78817109 TCAGCTCCAGAATTTCTGTTTGG + Intergenic
1043594226 8:81865038-81865060 TCAGCTCTAGAAGTTCAGTTTGG - Intergenic
1044185987 8:89252970-89252992 TCAGCTCTAGAAGTTCAATTTGG + Intergenic
1044223481 8:89697931-89697953 TCAGCTTTATCAGATCAGTTTGG + Intergenic
1045053263 8:98345821-98345843 TCATCTCTAGAAATTCAATTTGG - Intergenic
1045676441 8:104613523-104613545 TCAGCTCTATCAGATCAGTTTGG + Intronic
1046276196 8:111963938-111963960 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
1046795186 8:118364084-118364106 TCAGCTCTAAAAGGTCGGTTCGG - Intronic
1046930986 8:119841507-119841529 TCACCTCTACAAGATCGCTTGGG - Intronic
1046959993 8:120101439-120101461 TCAGCTCTATCAGATTGGTTTGG + Intronic
1047159450 8:122361164-122361186 TCATCTCTCTCAGATCAGTTTGG + Intergenic
1047164886 8:122426695-122426717 TCAGCTCTGTTTGATCAGTTTGG - Intergenic
1047548262 8:125840511-125840533 TCAGCTCCATCAGATCAGTTTGG - Intergenic
1048614756 8:136060572-136060594 TTAGCTCTAGAAGTTCAGTTTGG - Intergenic
1048639662 8:136339967-136339989 TCAGCTCTAGAATTTCTATTTGG - Intergenic
1050247801 9:3709348-3709370 TCATCTCTAGAAGTTCAATTTGG - Intergenic
1050402919 9:5275410-5275432 TCAGCTCTATTAGATTAGTTTGG - Intergenic
1051096802 9:13476135-13476157 TCAGCTCTATCGGATCAGTTTGG + Intergenic
1051726388 9:20091007-20091029 TCATCTCTGTCAGATCAGTTAGG - Intergenic
1051891455 9:21946338-21946360 TAAGCTATATCAGATCAGTTGGG - Intronic
1051932837 9:22407203-22407225 TCAGCTCTAGAATTTCAGTTTGG - Intergenic
1051946884 9:22580283-22580305 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1052075951 9:24140794-24140816 TAAGCACTAGAAGAACAGTGAGG - Intergenic
1052694220 9:31855072-31855094 TCAGCTCTATCAGATCAGTGTGG - Intergenic
1052895117 9:33740214-33740236 TCATTTCTAGAAGTTTAGTTAGG - Intergenic
1055131449 9:72779565-72779587 TCAGCTCTATCAGATCAGCTTGG - Intronic
1055207464 9:73750447-73750469 GTAGCTCTGGAAGTTCAGTTTGG + Intergenic
1055231558 9:74073147-74073169 TCAGCTCCATTAGATCACTTTGG + Intergenic
1055388225 9:75787972-75787994 TCAGCTCTGGAAGATCAGTTTGG + Intergenic
1055531888 9:77193177-77193199 TTAGCTCTGTCAGATCAGTTTGG + Intronic
1055618870 9:78102589-78102611 TTAGCTTTAGAAGAACAATTAGG - Intergenic
1055802357 9:80052474-80052496 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
1057225456 9:93290692-93290714 TCAGCTATAGCAGAGCAGTGCGG + Intronic
1057451630 9:95167633-95167655 TTAGCTCCAGAATATCTGTTTGG + Intronic
1057865502 9:98677199-98677221 TCAGCTCAAGAAGATAGGTCTGG + Intronic
1058198584 9:102009618-102009640 TCAGCTCTATCAGGTCAGTTTGG - Intergenic
1058572060 9:106357800-106357822 TCAGTTCTATCAGATTAGTTTGG + Intergenic
1058916322 9:109569287-109569309 TCAGCTCTGTCAGATCAGTTTGG - Intergenic
1059378394 9:113904250-113904272 TCATCTCTAGAAGTTTGGTTTGG + Intronic
1059484183 9:114614311-114614333 TCAGCTCTGGAAGATCACTTAGG - Intronic
1060206781 9:121686904-121686926 TGAGCCCTAGAAGTTCAGTCAGG - Intronic
1061535112 9:131243003-131243025 TCATCTCTACAAGTTCAGCTGGG - Intergenic
1186247831 X:7632664-7632686 TCAGCTTTAGAAGTTCAGTTTGG - Intergenic
1186696709 X:12041958-12041980 TCTCCTCTAGAATTTCAGTTTGG + Intergenic
1187325193 X:18279668-18279690 TCAGTTCTAGAAGTTCAGTTTGG - Intronic
1187607673 X:20904625-20904647 TCAGCTCTAGTACATCAGTTTGG + Intergenic
1187640108 X:21278013-21278035 TCCGCTCTGTCAGATCAGTTTGG - Intergenic
1188149725 X:26656896-26656918 TCAGATCTATCAGATCACTTTGG + Intergenic
1188185132 X:27104212-27104234 TCAGCTTTAAAAGATTACTTGGG + Intergenic
1188289616 X:28371337-28371359 TTAGCTCTATCAAATCAGTTAGG + Intergenic
1188360029 X:29241847-29241869 TCAGTTCTACAAAAGCAGTTGGG - Intronic
1188362462 X:29272970-29272992 TCAGCTCTATCTGATCAGTTTGG + Intronic
1188717498 X:33477769-33477791 TTAGCTCTATCAGATCAGTGTGG - Intergenic
1188739646 X:33762950-33762972 TCAGTTCTAGAATATCTGTTTGG + Intergenic
1188792511 X:34421198-34421220 TCACCTCTCTCAGATCAGTTAGG - Intergenic
1188941474 X:36242484-36242506 TCAGTTCCAGACGTTCAGTTTGG - Intronic
1189532412 X:41900574-41900596 TCAGCTCTAGAATTTCTGTTTGG + Intronic
1189673893 X:43442056-43442078 TTGGCTCTATCAGATCAGTTAGG + Intergenic
1189897919 X:45674504-45674526 TCAGCTCTGTTAGATCAGTTTGG - Intergenic
1190865201 X:54378560-54378582 TCATCTCTAGAAGTTCAATTTGG - Intergenic
1190898223 X:54641695-54641717 CCAGCTTTAGAAGATGAGGTGGG + Intergenic
1191072657 X:56418584-56418606 TCATTTCCAGAAGTTCAGTTTGG - Intergenic
1191085600 X:56564074-56564096 TCAGCACTAGCTGATCGGTTTGG - Exonic
1191135246 X:57057525-57057547 TCAGCTCCATCAGATCATTTAGG + Intergenic
1191223822 X:58018449-58018471 TCAGCTCTATCAGATCCATTAGG - Intergenic
1191654236 X:63578269-63578291 TCAGCTCTATTAGCTCAGTTTGG - Intergenic
1191763121 X:64665238-64665260 TCAGCCCTATAAGATCAATTTGG - Intergenic
1191821624 X:65315975-65315997 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1191919890 X:66244493-66244515 TCAGCTCTATCAGATTAGCTTGG + Intronic
1191944177 X:66513642-66513664 TCAGCTCTGTCAGATCACTTTGG + Intergenic
1192067537 X:67902680-67902702 TCAGCTTGATCAGATCAGTTAGG + Intergenic
1192076166 X:67999738-67999760 TCAGCTCTACCAAATCAGTTTGG + Intergenic
1192691604 X:73371309-73371331 TCAGTTCTATCAGATCAGCTTGG + Intergenic
1192711382 X:73593748-73593770 TCAATTCCAGAAGTTCAGTTTGG + Intronic
1192904421 X:75535453-75535475 TCACTTCTAGAAGATAACTTTGG - Intergenic
1192919853 X:75695157-75695179 TCAGCTCTAGAAGATTAGTCTGG - Intergenic
1192941277 X:75914031-75914053 TTATCTCTAGAAGTTCAGTATGG + Intergenic
1192982882 X:76366112-76366134 TCAGCTCTATCAGATTTGTTTGG + Intergenic
1193044330 X:77035408-77035430 TCAGCTCTTTCAGATCAGTTTGG - Intergenic
1193165746 X:78278079-78278101 TCAGCTCTAGAAGATCAGTTTGG - Intronic
1193223970 X:78959955-78959977 TCAGGTCTTGAAGATCAGCCGGG + Intronic
1193282101 X:79664625-79664647 TCAGCTCAAGAAGTTTAGTTTGG - Intergenic
1193358941 X:80557222-80557244 TGAGCTCTAGAATTTCAGCTTGG - Intergenic
1193392690 X:80948121-80948143 TAAGCTCTATGGGATCAGTTTGG + Intergenic
1193406153 X:81105161-81105183 TCAGCTCTATCAGTTCAGTGTGG + Intergenic
1193479421 X:82009559-82009581 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1193499563 X:82258617-82258639 TCAGCTCTACCAGCTCAGTTTGG + Intergenic
1193553127 X:82923889-82923911 TCAGCTCTATCAGATCAGCTTGG + Intergenic
1193570058 X:83129955-83129977 TCAGCTCTACCAGATGAGTTTGG - Intergenic
1193575514 X:83190993-83191015 TTAGCTCTAGAAGATCAGTTTGG + Intergenic
1193583842 X:83296090-83296112 TCAGCTCTATTAGATAAGTTTGG - Intergenic
1193624173 X:83795761-83795783 TCAGCTGTAGAATTTCTGTTTGG - Intergenic
1193638811 X:83985904-83985926 TTAGCTTTATCAGATCAGTTTGG - Intergenic
1193673012 X:84412985-84413007 TCAGCTCTATCAGGTCAGTTTGG + Intronic
1193714798 X:84925832-84925854 TCAGCTCTGTCAGATCTGTTAGG + Intergenic
1193749487 X:85325511-85325533 TCAGCTCTATTAAATCAGTTTGG + Intronic
1193752614 X:85365091-85365113 TCAGCTCTATCAGATCAGTTAGG + Intronic
1193814725 X:86090924-86090946 TCAGCTCTGTCAGATCAGTTTGG + Intergenic
1193854362 X:86580541-86580563 TCAGCTCTATCAGATTAGTTTGG - Intronic
1193947956 X:87762490-87762512 TCAGTTACAGAAGTTCAGTTTGG + Intergenic
1193979785 X:88168222-88168244 TCAGCTCCAGTTGATCATTTTGG + Intergenic
1194019299 X:88667179-88667201 TTAGTTCTAGAAGATTAGGTTGG - Intergenic
1194031608 X:88823654-88823676 TCAGCTCTATCATATCAGTTTGG + Intergenic
1194072880 X:89349749-89349771 TCAGCTCTAGAAGTTCAATTAGG + Intergenic
1194078356 X:89426263-89426285 TCAGCTGTAGAAAATCAGTTTGG - Intergenic
1194197463 X:90912978-90913000 TCAGTTCTAGAAGATCAGCTTGG - Intergenic
1194199158 X:90934031-90934053 TTAGCTCCAGAAATTCAGTTTGG + Intergenic
1194217307 X:91147181-91147203 TCAGCTCTGTCATATCAGTTTGG + Intergenic
1194236958 X:91396968-91396990 TGAGCCCTATCAGATCAGTTTGG - Intergenic
1194243418 X:91479828-91479850 TTAGCTCTAGAAGTTTAGTTTGG + Intergenic
1194245132 X:91501170-91501192 TCAGCTCTAGCAGTTTAGTTTGG - Intergenic
1194366593 X:93020617-93020639 TCAGCTCTAAAAGTTTAGTTTGG - Intergenic
1194468609 X:94264048-94264070 TCAGCTCTATAAGATCAGTTTGG - Intergenic
1194502149 X:94694850-94694872 TTAGTTCTAGAAGTTCACTTTGG + Intergenic
1194561696 X:95429284-95429306 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
1194774528 X:97945548-97945570 TCAGCTCTATCAGCTCAGTTTGG - Intergenic
1194851470 X:98875217-98875239 TCATCTCTATCAGATTAGTTTGG + Intergenic
1195018827 X:100805590-100805612 TCAGCTCCAGAATTTCTGTTTGG - Intergenic
1195142546 X:101977434-101977456 TCATTTCCAGAAGTTCAGTTTGG + Intergenic
1195148979 X:102045762-102045784 TCAGCTCTGTCAGATCTGTTAGG - Intergenic
1195155312 X:102116729-102116751 TCAGCCCTATAAGTTTAGTTTGG - Intergenic
1195172780 X:102285424-102285446 TTAGCTCAAGCAGGTCAGTTTGG + Intergenic
1195186086 X:102401671-102401693 TTAGCTCAAGCAGGTCAGTTTGG - Intronic
1195834284 X:109095369-109095391 TCAGGTCTATCACATCAGTTTGG + Intergenic
1195951262 X:110276210-110276232 TCAGCTCCAGAAGTTCCATTTGG + Intronic
1196227767 X:113187151-113187173 TCAGCTCTGTCAGATCTGTTAGG + Intergenic
1196244968 X:113390240-113390262 TCAGCTCTATCTGATCAGTTTGG + Intergenic
1196394885 X:115248670-115248692 TCATGTCTAGATGTTCAGTTGGG - Intergenic
1196515156 X:116602144-116602166 TCAGCTCTATCAGATCAGTTTGG - Intergenic
1196574306 X:117301092-117301114 TCAGCTCTGTCAGATCAGTTTGG + Intergenic
1196586939 X:117440702-117440724 TCAGCTCTATAAGATTAGTTTGG - Intergenic
1196595061 X:117536430-117536452 TCATTTCTAGAAGTTCAATTTGG + Intergenic
1196607873 X:117675878-117675900 TCAGCTCTATCACATCTGTTTGG - Intergenic
1197092958 X:122560092-122560114 TCAGCTCTATCAAATCAGTTAGG - Intergenic
1197422572 X:126257230-126257252 TTAGCTCTATCAGATCAGTTTGG + Intergenic
1197913499 X:131511436-131511458 TCAGCTATATTAGATCAGTTTGG + Intergenic
1197989080 X:132297671-132297693 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1198277649 X:135111817-135111839 TCAGCTCAAGGAGTTCAGTTTGG + Intergenic
1198626989 X:138587431-138587453 TCAGCTCTATCAGATAAGTTTGG + Intergenic
1198995811 X:142572411-142572433 TCAGCTCTGTAAGATCCATTAGG - Intergenic
1199063261 X:143384860-143384882 TCAGCTCTGTTAGATCAGTAAGG + Intergenic
1199182305 X:144872698-144872720 TCAGCTCTCTCAGATCAGCTTGG + Intergenic
1199219791 X:145305106-145305128 TCAGCTCTAAATGTTCAGCTTGG + Intergenic
1199240184 X:145538133-145538155 TCACCTCTATAAGTTCATTTTGG - Intergenic
1199245696 X:145600953-145600975 TCAGCTGTATCAGATTAGTTTGG - Intergenic
1199249158 X:145639208-145639230 TCAGCTCTGTCAGATCTGTTAGG - Intergenic
1199328891 X:146535466-146535488 TCACCTCTAGAATATCTATTTGG - Intergenic
1199399037 X:147375724-147375746 TTAGCTCTAGAAGTTTATTTTGG + Intergenic
1199400306 X:147390762-147390784 TCAGCTCTATTAGCTCAGTTTGG - Intergenic
1199407909 X:147484690-147484712 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1199521107 X:148736899-148736921 TGCTCTGTAGAAGATCAGTTGGG + Intronic
1199550333 X:149055033-149055055 TCATCTCCATAAGATCATTTGGG + Intergenic
1199707027 X:150436557-150436579 TCAACTCTCTCAGATCAGTTTGG + Intronic
1199786815 X:151113322-151113344 TCAGCTCTATCAGATCAGTTTGG + Intergenic
1199913134 X:152308941-152308963 TTAGCTCTATTAGATCAATTTGG - Intronic
1200316136 X:155135157-155135179 TCATCTCTAGAAGTTCCATTTGG - Intronic
1200360926 X:155605217-155605239 TCAGCTCTATCATATTAGTTTGG - Intronic
1200430997 Y:3081795-3081817 TCAGCTGTAGAAAATCAGTTTGG - Intergenic
1200544262 Y:4499819-4499841 TCAGTTCTAGAAGATCAGCTTGG + Intergenic
1200545152 Y:4510449-4510471 TTAGCTCCAGAAGTTCAGTTTGG + Intergenic
1200553821 Y:4610973-4610995 TCAGCTCTGTCATATCAGTTTGG + Intergenic
1200562401 Y:4721203-4721225 TTAGCTCTAGAAGTTTAGTTTGG + Intergenic
1200564105 Y:4742480-4742502 TCAGCTCTAGCAGTTTAGTTTGG - Intergenic
1200665064 Y:6012131-6012153 TCAGCTCTATCAGACAAGTTTGG + Intergenic
1200674822 Y:6136878-6136900 TCAGCTCTAAAAGTTTAGTTTGG - Intergenic
1200727120 Y:6685489-6685511 TCAGGTCTAGAAGTTCAATTAGG + Intergenic
1200728272 Y:6701264-6701286 TCAGGTCTAGAAGTTCAATTAGG + Intergenic
1200954354 Y:8929467-8929489 CCAGCTGAAGAAGCTCAGTTAGG + Intergenic
1200958146 Y:8971793-8971815 CCAGCTGAAGAAGCTCAGTTAGG + Intergenic
1201012144 Y:9557541-9557563 TCAGCTGAAGAAGCTCAGTTAGG + Intergenic
1201183442 Y:11373260-11373282 TCAGCTCTATCAGTTTAGTTTGG - Intergenic
1201521143 Y:14874937-14874959 TCAACTGTAGAAGATCATTCAGG - Intergenic
1201524588 Y:14917843-14917865 TAAGCTCCAGGAGATCAGATTGG + Intergenic