ID: 1093351259

View in Genome Browser
Species Human (GRCh38)
Location 12:18105544-18105566
Sequence CAGGAGCTGAACCAGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093351259_1093351265 6 Left 1093351259 12:18105544-18105566 CCCGCAGCCTGGTTCAGCTCCTG 0: 1
1: 0
2: 3
3: 27
4: 301
Right 1093351265 12:18105573-18105595 TCCTACAGTTCCTTGCCGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093351259 Original CRISPR CAGGAGCTGAACCAGGCTGC GGG (reversed) Intronic
900189545 1:1347506-1347528 CAGGAGCAGAACCTGGGGGCTGG + Intronic
900246276 1:1637565-1637587 CAGCAGCTGCACCCGGGTGCAGG - Intronic
900484561 1:2915307-2915329 CAGGAACTGTGCCAGGGTGCCGG + Intergenic
900590133 1:3455714-3455736 CAGGTGCTGTGCCTGGCTGCAGG + Intronic
900697105 1:4019282-4019304 CAGGAGCTCAAGGAGGCAGCTGG - Intergenic
900949833 1:5852487-5852509 CAGGGGCTGATACAGGCTGAGGG + Intergenic
901226023 1:7613465-7613487 CTGGAGCTGAGCCAGGCTGCAGG + Intronic
901602039 1:10430234-10430256 CAGGCGCTGAATCAGGCTCTGGG + Exonic
902532168 1:17097552-17097574 CGGGAGCTGTACCAGGCAACGGG + Intronic
902656987 1:17875928-17875950 CAGGGGGTGAAGCAGGCTCCAGG + Intergenic
903781282 1:25821417-25821439 CAGGACCTGGACCAGGCTTTGGG + Intronic
903976320 1:27152811-27152833 CAGGAGCTGAGCGGTGCTGCCGG - Intronic
904616543 1:31753131-31753153 CAGGAGCTGAGCCCTGCAGCTGG + Intronic
905137461 1:35810457-35810479 CAGAAACTGAACTAGGTTGCAGG - Intronic
907974180 1:59414829-59414851 CATTAGCTGAACCTGGCTGGAGG + Intronic
908801842 1:67888712-67888734 AAGGAGCTGAAAGAAGCTGCAGG + Intergenic
909898369 1:81102766-81102788 CAGGTGCAGAAACAGGCTGTAGG + Intergenic
912072508 1:105829643-105829665 CAGGAGCTGAACCTTTCTGGTGG + Intergenic
912272750 1:108227727-108227749 CAGAGCCTGAACCAGGCTCCAGG - Intronic
912295470 1:108466595-108466617 CAGAGCCTGAACCAGGCTCCAGG + Intronic
917521426 1:175751124-175751146 GAGGAGCAGAACCAGGCTGGGGG - Intergenic
919802278 1:201361151-201361173 CAGGAGCTGAAGGGGGCTGTTGG + Intronic
920533542 1:206722745-206722767 AAGGTGCTGGAGCAGGCTGCAGG - Intronic
922883077 1:228997215-228997237 CAGGAGTTAAACCAGGCTTCTGG + Intergenic
1068557037 10:58469636-58469658 GAGGAGCACAACCAGGCTGTAGG + Intergenic
1069594681 10:69663035-69663057 CAAGAGCTGGACCAGGGAGCAGG + Intergenic
1069605878 10:69738280-69738302 CAGGAGCTTGGCCAGGCTTCTGG + Intergenic
1070540726 10:77413392-77413414 CAGGAGGTGAAAGAGGTTGCTGG - Intronic
1070759537 10:79015141-79015163 CAGCATGTGGACCAGGCTGCCGG + Intergenic
1070796820 10:79221687-79221709 CAGGAGCTGAGACAGGCAGAAGG - Intronic
1070807126 10:79277174-79277196 CAGGAGGACAACAAGGCTGCAGG - Exonic
1072732216 10:97853846-97853868 CAAGAGCTAAGCCAGGCTCCAGG - Intronic
1074531581 10:114302126-114302148 AAGGAGCCGAGCCAGGCTTCGGG - Intronic
1075040568 10:119104226-119104248 CAGAGGCAGAACCAGGGTGCGGG - Intronic
1075316537 10:121457956-121457978 CAGCTGCAGAAACAGGCTGCAGG - Intergenic
1076475570 10:130749596-130749618 CAGCAGCTCCTCCAGGCTGCTGG + Intergenic
1076530573 10:131141807-131141829 CAGGGGCTGAGCCAGGCTCCTGG - Intronic
1076807711 10:132867282-132867304 CTGCAGCTGAGCCAGGCGGCCGG - Intronic
1076916266 10:133424322-133424344 CAGCTGCTGAACTAGGCGGCCGG - Intronic
1076936373 10:133569117-133569139 CAGCTGCTGAACTAGGCGGCCGG - Intronic
1077426731 11:2483543-2483565 GAGGAGCTGGCACAGGCTGCAGG - Intronic
1077501703 11:2912388-2912410 CAGGAGCCAGAACAGGCTGCAGG - Intronic
1078081525 11:8207679-8207701 CAGGACCTGCACCTGGCCGCCGG + Intergenic
1081869979 11:46378994-46379016 CAGGAGCTGCACCGAGCTGGGGG + Exonic
1082785318 11:57313407-57313429 TCGGCGCTGAACCAGGCTGGTGG + Exonic
1083364152 11:62131226-62131248 CAGGACCTGCCCCAGGCTGCAGG - Intronic
1083673594 11:64313739-64313761 GAGGAGCTGGACCAGGCAGCGGG - Intronic
1084342486 11:68515300-68515322 CAGGAACTGGACCAGCCTGTCGG + Intronic
1084356778 11:68644158-68644180 CAGGAACTGGACCAGCCTGTCGG + Intergenic
1084603825 11:70161552-70161574 CAGAAGCTGGACCAGGCTGTTGG + Intronic
1084733724 11:71091283-71091305 CAGGGGCTTCTCCAGGCTGCAGG + Intronic
1085024372 11:73228081-73228103 CTGGACCTGGACCGGGCTGCAGG - Exonic
1085724846 11:78945616-78945638 CAGAAGCTGAGACAGGCTGAAGG + Intronic
1086553998 11:88087962-88087984 CAGGAGCTGAAAAAGGGTGGTGG + Intergenic
1088774187 11:113066487-113066509 CAGGATCAAAACCAGGCTTCAGG + Intronic
1089321163 11:117627596-117627618 GAGGAGCTGAACCAAGCCACGGG - Intronic
1090412481 11:126518757-126518779 CAGCAGCTGACCCAGCCAGCTGG - Intronic
1091215142 11:133896741-133896763 CCTGAGCTGAGGCAGGCTGCAGG + Intergenic
1091237579 11:134032456-134032478 GAGGAGCTGAGCCAGGCAGCCGG + Intergenic
1093351259 12:18105544-18105566 CAGGAGCTGAACCAGGCTGCGGG - Intronic
1095347444 12:41168246-41168268 CAGAAGCTGAACCACTCTGAGGG + Intergenic
1096397600 12:51278159-51278181 CAAAAGAAGAACCAGGCTGCAGG - Intergenic
1099239546 12:80122948-80122970 CAGAGCCTGAACCAGGCTCCAGG + Intergenic
1101021003 12:100553762-100553784 CAGGAGGAGAACCAGCCTGTGGG - Intronic
1101150330 12:101877603-101877625 GAGGAGCGGAGCGAGGCTGCGGG - Exonic
1103590857 12:121991233-121991255 CAGGCTCTGAACTAAGCTGCCGG + Intronic
1104045810 12:125162048-125162070 CAGGAGGGGAACAAGGCTGCAGG - Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105069481 12:133226089-133226111 CAGGTGATGAGTCAGGCTGCAGG + Intronic
1105754590 13:23452877-23452899 CAGGAGCTGTACCAGGCCTTAGG + Intergenic
1105934656 13:25088054-25088076 CAGGAGCTGACTGAGGCTGGTGG - Intergenic
1106242918 13:27924706-27924728 CAGGAGCTGCTCCTGGCTGAGGG + Exonic
1106328237 13:28715335-28715357 CAGCAGCTGGGCCAGGCTGGAGG + Intronic
1106332234 13:28749755-28749777 CATGAGCAGAAGCAGCCTGCGGG + Intergenic
1107787571 13:43970845-43970867 CAGGAGCTGCACCGAGCTGGGGG + Intergenic
1111113455 13:83745816-83745838 CAGTAGCTGATGCAGGCTGGTGG - Intergenic
1112334130 13:98499981-98500003 CAGGAGCTGAACCCTGCAGTAGG - Intronic
1113606387 13:111610625-111610647 CAGGAGCAGTACCTGGCTTCAGG - Intronic
1113802834 13:113095434-113095456 CAGGAGGGGAAACAGGCTGGTGG + Intronic
1113831471 13:113298697-113298719 CAGGAGCTGAGCAAGGCTTCAGG - Intronic
1113982515 13:114288367-114288389 CTGGAGCTGAGACTGGCTGCGGG + Intronic
1114730354 14:24986519-24986541 CAACAGCTGATCCAGGCTCCTGG - Intronic
1115928084 14:38460021-38460043 TAGGAGTTGAACCAGGCAGAGGG + Intergenic
1118309926 14:64684584-64684606 GAGAATCTGACCCAGGCTGCGGG + Intergenic
1121096302 14:91220182-91220204 CAGGGCTTGAACCAGGCAGCCGG - Intronic
1121495100 14:94386627-94386649 CAGGAGCTCAACCTGTGTGCAGG - Intronic
1122938681 14:104971657-104971679 CAGGAGGTGGGCCAGGCAGCTGG - Intronic
1124019022 15:25903091-25903113 CAGCAACTGACCCAGGCTGGAGG - Intergenic
1124112421 15:26804405-26804427 CCTCAGCTCAACCAGGCTGCCGG + Intronic
1124649586 15:31465022-31465044 AAGGAGCCAAGCCAGGCTGCAGG - Intergenic
1124700884 15:31910767-31910789 CAGGCTCTGAACCAGACTTCTGG + Intergenic
1125610592 15:40966890-40966912 CAGGAGGGGAACCGGGCTCCAGG + Intergenic
1132028227 15:98420651-98420673 CTGGAGCTGAGCGAGGCTCCCGG - Intergenic
1132716082 16:1290428-1290450 AGAGAGCTGGACCAGGCTGCTGG - Intergenic
1133001925 16:2856208-2856230 CAGCAGCTGAACCGGGTTGTGGG - Exonic
1133273113 16:4620696-4620718 CAGGTGATGAACCAGGCAACAGG - Intronic
1133996485 16:10752383-10752405 GAGGAGCTCAGCCAGGCTGAGGG + Intronic
1135619434 16:23942855-23942877 CAGAAGCTGAACCAGACTAGGGG - Intronic
1135826359 16:25732102-25732124 CAGTAACTGGATCAGGCTGCTGG + Intronic
1136453012 16:30364987-30365009 CAGGAGCTGGAACGGGCTCCTGG - Exonic
1137633958 16:49969468-49969490 CAGGGACTGAACCACGCTGGCGG + Intergenic
1137897547 16:52230348-52230370 AATGAGCTGAACCAGGAAGCAGG - Intergenic
1138482276 16:57311394-57311416 GGGGAGCTGACCCAGGCTGGAGG - Intergenic
1138521125 16:57571395-57571417 CAGGCTCTGGACCAGCCTGCCGG - Intronic
1138656763 16:58495934-58495956 CGGGAGCTGGCCCAGGCTGGTGG + Intronic
1139659630 16:68411902-68411924 CAGGTGCTGATCCAGACTCCTGG - Intronic
1141096276 16:81165313-81165335 CAGGAGCTGGACAATGCTGCTGG - Intergenic
1141132175 16:81444444-81444466 CGGGAGCCCAGCCAGGCTGCCGG - Intergenic
1141580450 16:84994573-84994595 CAGGACCTGAACCAGGAAGGCGG - Intronic
1141983085 16:87561878-87561900 CACGAGGTGTACCAGGCTGGAGG + Intergenic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142128069 16:88419966-88419988 CAGTAGCAGACCCTGGCTGCAGG + Intergenic
1142698484 17:1646080-1646102 CAGGAGCAGAGGCAGGCTGAGGG - Intergenic
1142746022 17:1958687-1958709 CAGCAGCTGAGGCAGGCAGCTGG + Intronic
1143788357 17:9273550-9273572 CAGGAGCTGAATCATTCTGCAGG - Intronic
1145252074 17:21302107-21302129 CCAGAGCTCAGCCAGGCTGCCGG - Intronic
1145941462 17:28745289-28745311 CAGGAGCCGGCCCAGGCTGTGGG - Intronic
1146515542 17:33486436-33486458 CAGGTGCTGTACCAGGCTCCAGG - Intronic
1147597079 17:41724299-41724321 CGGGGGCTGACCCAGGCTGGAGG - Exonic
1147677570 17:42218676-42218698 CAGGAGCTGCCCCAAGCTCCTGG + Intronic
1147688469 17:42300895-42300917 CAGGAGCTGCCCCAAGCTCCTGG - Intronic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148085651 17:44992288-44992310 CAAGAGCTGAACCTGCCTCCTGG - Intergenic
1148462330 17:47845931-47845953 CAGAAGCTGAGCCAGGCAGAGGG - Exonic
1148486787 17:47995881-47995903 CAGGTGCTGAACTAGGCAACTGG + Intergenic
1149356585 17:55845697-55845719 CAGGTGCTGAAGGAGGCCGCAGG - Intergenic
1152742080 17:82022829-82022851 CAGGAGCTGGATCCGGCTTCCGG - Exonic
1152742517 17:82024564-82024586 CAGGAGCTGAGGAAGGCTGCAGG + Intronic
1152781321 17:82228581-82228603 CCGGAGCTGAGCCAGGCGGCCGG + Intronic
1153869437 18:9303620-9303642 CAGCAAGTGTACCAGGCTGCAGG - Intergenic
1155796585 18:30045023-30045045 CAGGCCCAAAACCAGGCTGCGGG - Intergenic
1156914927 18:42454458-42454480 CAGGATATGAACAAGGGTGCTGG + Intergenic
1157455352 18:47823444-47823466 CAGGAGCAAATCCAGTCTGCAGG - Exonic
1157582482 18:48781617-48781639 CAGGCCCTGAACCCTGCTGCTGG - Intronic
1158015350 18:52776601-52776623 CAAGTGCTGAGCCAGGTTGCAGG + Intronic
1158045890 18:53154785-53154807 CAGGAGGAGAAGCAGGCTGAGGG + Intronic
1160504806 18:79421035-79421057 GAGGAGCAGAATCAAGCTGCAGG - Intronic
1160569098 18:79804362-79804384 CCGGTGCTGCACCAGGCTCCAGG + Intergenic
1160829812 19:1098504-1098526 CAGGACCTGGTCCAGGCTCCCGG - Intergenic
1161310556 19:3591693-3591715 CTGGAGCTGGACTGGGCTGCAGG - Exonic
1161561887 19:4977897-4977919 CAGGACCCAAGCCAGGCTGCTGG + Intronic
1161736428 19:5994883-5994905 CAGGGGCTCACCCAGGCTGCGGG + Exonic
1162305451 19:9870519-9870541 CAGGCACTGAACCAGGATGTAGG + Intronic
1162573001 19:11483298-11483320 CAGGGGCTGTGCGAGGCTGCTGG + Intronic
1163009085 19:14413544-14413566 GAGCAGCTGAACAAGGCTGGGGG - Intronic
1163673423 19:18642747-18642769 CAGGAGGTCAAGAAGGCTGCAGG - Intronic
1164783309 19:30910629-30910651 CAGGCCCTGCTCCAGGCTGCTGG - Intergenic
1166369222 19:42292120-42292142 CAGGGGCGGCACCAGGCCGCTGG - Exonic
1167104468 19:47421999-47422021 CTGGAGCTGGGCCAGGCAGCGGG - Intergenic
1167632673 19:50635361-50635383 CAGGGTCTGAATCAGGCTGGCGG - Intronic
1168152040 19:54454549-54454571 CTGGAGCTGTCCCAGGCTGAGGG - Exonic
925228469 2:2207696-2207718 CAGGATCTGATGCAGGCTGTGGG + Intronic
925979486 2:9165329-9165351 CAGAAGGTGAACCAGGCAGTCGG + Intergenic
932261475 2:70331113-70331135 AAGGATGTGAACCAGGCTGCAGG + Intergenic
932504121 2:72212256-72212278 TAAGAGCTGAATCAGGCTGTTGG - Intronic
933858391 2:86441265-86441287 CAGGAGCTGGGCGAGGCTCCGGG - Exonic
934601639 2:95662795-95662817 CAGGAGGCAGACCAGGCTGCTGG + Intergenic
934915866 2:98300597-98300619 CAGGAGGTGACCAAGTCTGCAGG - Intronic
936475309 2:112834574-112834596 CTGGAGCAGAGCCAAGCTGCTGG + Intronic
936535001 2:113304961-113304983 CAGGAGGCAGACCAGGCTGCTGG + Intergenic
937112005 2:119373662-119373684 CAGGTGCAGCCCCAGGCTGCTGG - Intergenic
937253954 2:120541583-120541605 CAGCAGCTGAAGGAGGCTGCTGG + Intergenic
937270953 2:120652292-120652314 CAGGAGCTGAGCCCGGCTGGAGG + Intergenic
937475388 2:122210370-122210392 CAGGAGATGGACCCTGCTGCTGG + Intergenic
938412599 2:131077362-131077384 CAGGAGCAGGACCAGGCCGCTGG + Intronic
942226810 2:173823717-173823739 CAGGTGCTGAGGAAGGCTGCTGG - Intergenic
942297700 2:174533727-174533749 CAGCTGCCAAACCAGGCTGCAGG + Intergenic
942930851 2:181490639-181490661 CAGGATCTGGACCAGGCTGCAGG + Intronic
947588823 2:231372981-231373003 CACGAGATGAACCAGGGTCCCGG - Intronic
947593747 2:231398636-231398658 CAGGCGCCGGGCCAGGCTGCCGG - Exonic
947715601 2:232337475-232337497 CAGGAGGGGAAACTGGCTGCTGG + Intronic
947721126 2:232369826-232369848 CAGGAGGGGAAACCGGCTGCTGG + Intergenic
948747844 2:240108942-240108964 CAGAAGCTGAACAGGGCAGCTGG + Intergenic
948884588 2:240876372-240876394 TAGGAGCTGGACAAGCCTGCAGG - Intronic
948903068 2:240965852-240965874 CAGGAGCTGGCCCAGGCTGAGGG + Intronic
948908544 2:240991588-240991610 CTGGTGCTGGACCATGCTGCGGG + Intronic
948916887 2:241038984-241039006 CAAGACCTGAACCAGCCTCCTGG - Intronic
1168963304 20:1883364-1883386 CAGGAGCTGACACAGGCTGCAGG - Intergenic
1170570913 20:17632125-17632147 CAGGACCTGAACCCGACAGCTGG + Intronic
1171033495 20:21697526-21697548 CAGATGCTGAACGAGGGTGCAGG - Intergenic
1171354893 20:24536441-24536463 AAGGAGCTGATCCAGGCAGCCGG - Intronic
1172320158 20:33990252-33990274 CAGGAGATGAGGCAGGCTTCAGG + Intergenic
1172731940 20:37095831-37095853 CAGGAGCTGAACCTGGACGAGGG - Exonic
1174378839 20:50143548-50143570 CAGGAGATGGACCAGGTTGTGGG + Exonic
1175201427 20:57280489-57280511 CAGGTGTTGAACCAGGAGGCAGG - Intergenic
1175262125 20:57681305-57681327 CAGGAGCTCAGGCAGGCGGCAGG - Intronic
1175339459 20:58218899-58218921 CTGGAGCTGGGCCAGGCAGCAGG - Intronic
1178434853 21:32549136-32549158 CAGGACCTGACCCTGGCTCCCGG + Intergenic
1178747221 21:35264751-35264773 GATGATCTGAACCAGGCTACTGG - Intronic
1178911023 21:36673831-36673853 GAGAAGCTGAAACAGGCAGCAGG + Intergenic
1180618256 22:17142995-17143017 TTGCTGCTGAACCAGGCTGCAGG + Intronic
1180706902 22:17815787-17815809 GAGGAACTGGATCAGGCTGCAGG + Intronic
1180795305 22:18601048-18601070 CAGGATCTGTACCAGGGTGTTGG - Intergenic
1181226435 22:21394264-21394286 CAGGATCTGTACCAGGGTGTTGG + Intergenic
1181252215 22:21540574-21540596 CAGGATCTGTACCAGGGTGTTGG - Intergenic
1182298872 22:29327128-29327150 CTGGAGCTGAAACAGGCTGAGGG + Intergenic
1182347158 22:29674322-29674344 GAGGATCTGCACCAGGGTGCGGG + Intronic
1182459053 22:30471552-30471574 TAGGAGCTGAAAGATGCTGCTGG - Intronic
1183124803 22:35766761-35766783 CAAGAGCTGAAACCAGCTGCTGG + Intronic
1183605231 22:38863970-38863992 CGGGAGCTAACCCAAGCTGCAGG - Exonic
1183653282 22:39171238-39171260 CAGGATGTGACCCAGCCTGCAGG - Intergenic
1183680002 22:39322636-39322658 CGGGTCCTGCACCAGGCTGCAGG + Intergenic
1184476091 22:44722214-44722236 CAGGAGCAGGGCCAGGCTCCAGG + Intronic
1184476906 22:44726934-44726956 CAGGGGCTCTCCCAGGCTGCGGG - Intronic
1185179365 22:49350273-49350295 CAGGGGCTGTCCCTGGCTGCCGG + Intergenic
949709711 3:6860502-6860524 CAGGAGCTGAGCTTGGCTGCAGG - Intronic
949857565 3:8475823-8475845 CAGGCACTGGACCTGGCTGCAGG + Intergenic
950670137 3:14521036-14521058 AAGGGACTGAACCAGGCTGGTGG - Intronic
953235585 3:41103552-41103574 CAGGGGCTGGGCCAGGCTGTTGG - Intergenic
953238371 3:41126088-41126110 CAGAAGCTGTCCTAGGCTGCAGG + Intergenic
953244325 3:41176931-41176953 CAGGAGGTGAACCTGGCTGGTGG + Intergenic
954313278 3:49786479-49786501 CGGGAGCTGGACCAAGCGGCCGG - Intronic
955035610 3:55264316-55264338 AAGGATCTGAATCAGGGTGCAGG - Intergenic
956462435 3:69485375-69485397 CTGGAGCTGCACCAGGGTGGGGG + Intronic
961525913 3:127497239-127497261 CTGCAGCTGGACCAGGCTTCTGG - Intergenic
961550391 3:127667570-127667592 CAGGATGTGAACCAGGAGGCAGG + Intronic
964754569 3:160082054-160082076 CAGGAGGTTAATAAGGCTGCTGG - Intergenic
966962749 3:184956299-184956321 CAAGAGCTGAGACAGTCTGCAGG - Intronic
967100535 3:186211745-186211767 CAGGAGCAGAACCAAGATCCAGG + Intronic
968230477 3:197002565-197002587 CCGGAGGTGACCCAGGCCGCGGG - Exonic
968490029 4:885063-885085 CAGGTGCTGACTCAGGATGCGGG + Intronic
968490038 4:885132-885154 CAGGTGCTGACACAGGATGCGGG + Intronic
968524583 4:1049490-1049512 CAGGAGGTGAGCAAGGCTGAGGG - Intergenic
968551927 4:1228324-1228346 CAGGTCCTGAACGAGGCTGTGGG - Exonic
968605309 4:1532537-1532559 CAGGTGCGGAGCCAGGCTGCCGG - Intergenic
969339504 4:6531273-6531295 GAGGGGCTGAGGCAGGCTGCAGG + Intronic
969531958 4:7735180-7735202 CCGGAGCTGAACCAGCAGGCAGG - Intronic
969655652 4:8496494-8496516 CAGGAGCTCAACCATGCAGTTGG + Intergenic
970596524 4:17605238-17605260 CAGAAGCTGAACCAGGTGTCAGG - Intronic
971823868 4:31595979-31596001 CAGGAGCTGAGCCAGGGTTGGGG - Intergenic
973637284 4:52871707-52871729 GAGGAGCTGAGCCAGGCCGGTGG - Intergenic
975266662 4:72377147-72377169 CAGGAGCTCAAGCAGGGTGGTGG - Intronic
977726888 4:100306281-100306303 CAGGAGATTAACCAGACTGCTGG - Intergenic
979036165 4:115721179-115721201 CAGGACCTGAACCAGACTCAGGG - Intergenic
983936486 4:173506371-173506393 CAGGAGACGGCCCAGGCTGCAGG + Intergenic
985672506 5:1213739-1213761 CAGGAGCTGCCCCAGGCCCCAGG - Intronic
985675818 5:1230811-1230833 CAGGTGCTGGGACAGGCTGCGGG - Intronic
985834242 5:2259034-2259056 CAGGAGGTCTACGAGGCTGCAGG - Intergenic
988849482 5:35164749-35164771 AAGCAGTGGAACCAGGCTGCTGG + Intronic
991639607 5:68739440-68739462 CATGGGCTGCACCTGGCTGCAGG - Intergenic
992231775 5:74670923-74670945 CAGGATCTGTACCAGAATGCAGG + Intronic
992484726 5:77183490-77183512 GTGGAGCTGAACCAGCCAGCTGG + Intergenic
993307805 5:86292234-86292256 CAGAGCCTGAACCAGGCTCCAGG + Intergenic
994647484 5:102489144-102489166 CAAGAGCTGCATCAGCCTGCAGG + Intronic
995527082 5:113058785-113058807 CAGGCCCTGAAGCAGGCAGCTGG + Intronic
997016310 5:129938856-129938878 CAGAGGCTGGAACAGGCTGCAGG - Intronic
997422306 5:133779217-133779239 CAGGAGTGGAAGGAGGCTGCGGG - Intergenic
997867958 5:137481537-137481559 CAGAAGCTCAACCATTCTGCTGG + Intronic
999237520 5:150107958-150107980 CAGGAGAGGAACCAGGCCACTGG + Intronic
1002471815 5:179439978-179440000 AAGGAGCTGCGCCAGGCTGTTGG + Intergenic
1002786063 6:401529-401551 CAGGACCTGGTCCAGGTTGCTGG - Exonic
1003007818 6:2398069-2398091 CCTGAGCTCAAGCAGGCTGCTGG + Intergenic
1003984109 6:11418440-11418462 CAGGATCTGAAACTGACTGCTGG - Intergenic
1004516600 6:16326865-16326887 CAGGTGCTGGGGCAGGCTGCCGG + Exonic
1006177054 6:32128765-32128787 CAGGGGAAGAACCAGGATGCAGG - Exonic
1006385966 6:33731135-33731157 CAGGAACTGCACGAGGCTGCTGG - Intronic
1006422422 6:33943632-33943654 GAGGAGCTGGTCCAGGCTGTGGG - Intergenic
1007173141 6:39878526-39878548 CAGGAGCTGCGCCAGGCTCGGGG + Exonic
1007227532 6:40325526-40325548 CAGGTCCCTAACCAGGCTGCGGG - Intergenic
1007744687 6:44036321-44036343 CAGGAACTGAACCAGGAGCCTGG - Intergenic
1007825823 6:44599919-44599941 CATGCTCTGAACCAGGCAGCTGG - Intergenic
1007965993 6:46004198-46004220 CAGGAGGTGAGAGAGGCTGCAGG + Intronic
1009398825 6:63230672-63230694 CAGGACCTGGACCAGGCACCAGG - Intergenic
1011173560 6:84534554-84534576 GAGGAGCTGATCTAGGCTACTGG - Intergenic
1011347611 6:86389131-86389153 CAGGGGTTGAAACAGGCTGAAGG + Intergenic
1013734037 6:113205084-113205106 CATGAGCTGACCCTGGATGCAGG - Intergenic
1014700840 6:124686104-124686126 TAGGAGCTGAAAGAGTCTGCTGG - Intronic
1014887994 6:126805506-126805528 TAGGTGCTGAACCAAGCTGATGG + Intergenic
1015179477 6:130346251-130346273 CATGAGCTGAAGCAGGGTGAGGG + Intronic
1016631746 6:146240992-146241014 CAGGAGGGAAACCAGCCTGCAGG + Intronic
1016874373 6:148850281-148850303 CAGACGCTGGTCCAGGCTGCTGG - Intronic
1017616683 6:156253632-156253654 CAGGACCTGACCCTGGCTCCCGG + Intergenic
1018732793 6:166665421-166665443 CAGCAGCTGCACAAAGCTGCTGG + Intronic
1019602951 7:1894433-1894455 CTGGAGCTGAACCAGCCAACAGG + Intronic
1019607974 7:1919532-1919554 TAGAAGCTGAGCCAGGCTGGTGG - Intronic
1019932453 7:4233312-4233334 CCGGAGCTTATCCAGGCTGAGGG - Exonic
1022560691 7:31346082-31346104 CAGCAGCTGTACAAGGCTGTGGG + Intergenic
1023037730 7:36147818-36147840 CAGGAGATGGACCATGCTGGAGG + Intergenic
1025150159 7:56541260-56541282 GAGGACCTGCACCAGGCTGGGGG + Intergenic
1025260954 7:57417098-57417120 GAGGACCTGGACCAGGCTGGGGG + Intergenic
1025977296 7:66379059-66379081 CAGGAGCTCAGCCAGGTCGCAGG + Intronic
1027744643 7:82057807-82057829 CAGGAGTTGGCCAAGGCTGCAGG + Intronic
1029128602 7:98312882-98312904 CAGGAGCAGAGCCAGGCTTGTGG - Intronic
1029344361 7:99967585-99967607 CATGGGCTGAACCAAGCAGCTGG - Intronic
1029347126 7:99986895-99986917 CATGGGCTGAACCAAGCAGCTGG + Intergenic
1029536355 7:101160071-101160093 GGGAAGGTGAACCAGGCTGCAGG - Intronic
1030707584 7:112710555-112710577 CAGGAGCTCAACTAAGCTGGAGG + Intergenic
1030766935 7:113421780-113421802 CAGGAGCAGAACCCAGCTGAGGG - Intergenic
1030798900 7:113825029-113825051 CAGGAGGAGAACCTGACTGCAGG - Intergenic
1033550239 7:142440316-142440338 CAGGAGCTGAATCAGTGTCCCGG - Intergenic
1034115135 7:148577627-148577649 CAGGAGCTGGACCTGGCTCAAGG + Intergenic
1034412128 7:150947272-150947294 CAGGACCTGGACCAGACTCCAGG + Intronic
1034992223 7:155555164-155555186 CGGGGGCTGGGCCAGGCTGCGGG - Intergenic
1035239922 7:157523003-157523025 CAGGAGCTGCCGGAGGCTGCGGG - Intergenic
1036089373 8:5648585-5648607 CATGTGGTGAACCTGGCTGCAGG + Intergenic
1037828889 8:22176882-22176904 CAGGGGCGGGGCCAGGCTGCCGG - Intronic
1041324462 8:56650325-56650347 CCTGAGCTGACCAAGGCTGCAGG - Intergenic
1041704890 8:60836141-60836163 CAGGCAATGATCCAGGCTGCTGG + Exonic
1044060711 8:87631688-87631710 CAGGAGCAACACCATGCTGCTGG + Intergenic
1045277370 8:100720892-100720914 CAGGAGCAGAAGCAGGCCTCGGG + Intronic
1045501515 8:102747627-102747649 CAGGTGCAGACCCAGGCAGCAGG - Intergenic
1045532995 8:103002004-103002026 CAGGGGCTGAACCAGGATATCGG + Intergenic
1047547306 8:125831188-125831210 GAGGAGCTGACCCAGCCTGAAGG - Intergenic
1048829394 8:138461254-138461276 CAGGAAGTGGACCAGGGTGCTGG + Intronic
1049256656 8:141617713-141617735 ATGGAGGTGGACCAGGCTGCAGG + Intergenic
1049438292 8:142597713-142597735 CAGGAGGTGGTTCAGGCTGCAGG + Intergenic
1050412090 9:5376869-5376891 GAGGAGGTGAACCAGGTGGCTGG + Intronic
1055945179 9:81687415-81687437 CAGACGCCGCACCAGGCTGCAGG - Exonic
1056763284 9:89429216-89429238 CAGGAGTTGTACCAGGCCGGCGG + Intronic
1059424991 9:114215413-114215435 CCAGAGCTGACCCAGGCTGTTGG + Intronic
1059536045 9:115081850-115081872 CAGGAGCTAGACCAGTTTGCCGG + Exonic
1059938715 9:119337067-119337089 CAGGAGCTGAATTAGGAGGCTGG - Intronic
1060050158 9:120372905-120372927 GAGGAACTGATCCAGGCTGAAGG + Intergenic
1060050169 9:120372984-120373006 GAGGAACTGATCCAGGCTGAAGG + Intergenic
1060195361 9:121620189-121620211 CAGCAGCTGGCCCAGGCAGCAGG - Intronic
1060303441 9:122390127-122390149 CAGGAACTTACCCAGGCTCCAGG + Intronic
1060539721 9:124421239-124421261 CAGCAGCTGCTCCAGGCTCCAGG + Intergenic
1060781279 9:126415120-126415142 CAGGAGCTGCACTAGGCCACTGG - Intronic
1061369327 9:130189139-130189161 CAGAACCTGAGCCAGGCTCCAGG - Intronic
1061957606 9:133971697-133971719 CAGGAGCTGGTCCAGGGTGTGGG + Intronic
1062012175 9:134273107-134273129 CAGGAGATGACCCAGCCTCCCGG - Intergenic
1188599241 X:31941116-31941138 CAGTTGCTGAAACAGGCTTCGGG + Intronic
1189408214 X:40744761-40744783 CAGGAGCTGCCCAAGGCTGTGGG - Intergenic
1192537255 X:71938812-71938834 CAGGACCTGTTCCAGGCAGCTGG + Intergenic
1193733238 X:85126768-85126790 CAGGACTTGAACCAGCCTCCAGG + Intergenic
1195992375 X:110695475-110695497 CAGGAGCTAAAGTAGGCTGGGGG + Intronic
1196767195 X:119257395-119257417 CAGGATCTGAACCAAACTTCGGG + Intergenic
1196775029 X:119330598-119330620 GAGAAGCTGTACCAGACTGCAGG - Intergenic
1199565526 X:149211822-149211844 AAGGCCCTGAACCAGGCTTCTGG + Intergenic
1201783049 Y:17744309-17744331 CAGGTGATGAGTCAGGCTGCAGG + Intergenic
1201818504 Y:18161678-18161700 CAGGTGATGAGTCAGGCTGCAGG - Intergenic
1202202432 Y:22367398-22367420 CAGGTGCTAAACCCAGCTGCTGG + Intronic