ID: 1093351638

View in Genome Browser
Species Human (GRCh38)
Location 12:18109586-18109608
Sequence AAATTTAACATGTCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 1, 2: 7, 3: 62, 4: 491}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093351638_1093351641 -8 Left 1093351638 12:18109586-18109608 CCAGTTTTAGACATGTTAAATTT 0: 1
1: 1
2: 7
3: 62
4: 491
Right 1093351641 12:18109601-18109623 TTAAATTTAAGTTACTGTTGGGG 0: 1
1: 0
2: 3
3: 25
4: 384
1093351638_1093351640 -9 Left 1093351638 12:18109586-18109608 CCAGTTTTAGACATGTTAAATTT 0: 1
1: 1
2: 7
3: 62
4: 491
Right 1093351640 12:18109600-18109622 GTTAAATTTAAGTTACTGTTGGG 0: 1
1: 0
2: 3
3: 18
4: 283
1093351638_1093351642 24 Left 1093351638 12:18109586-18109608 CCAGTTTTAGACATGTTAAATTT 0: 1
1: 1
2: 7
3: 62
4: 491
Right 1093351642 12:18109633-18109655 TCATCTGTGCAGTAGTGAGTTGG 0: 1
1: 0
2: 0
3: 11
4: 151
1093351638_1093351639 -10 Left 1093351638 12:18109586-18109608 CCAGTTTTAGACATGTTAAATTT 0: 1
1: 1
2: 7
3: 62
4: 491
Right 1093351639 12:18109599-18109621 TGTTAAATTTAAGTTACTGTTGG 0: 1
1: 0
2: 3
3: 28
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093351638 Original CRISPR AAATTTAACATGTCTAAAAC TGG (reversed) Intronic
901513309 1:9729270-9729292 AAATTTTAGATTTCTAAAACAGG - Exonic
903556920 1:24200751-24200773 AAATGTAGCATGTCTAAATATGG - Intergenic
903618068 1:24676681-24676703 AAAATTAACATGTCCAAAATAGG + Intergenic
903726617 1:25451978-25452000 GAATTTAACATATCAAAAATAGG - Intronic
905837421 1:41138891-41138913 AAATTTAAGATATATAAAAATGG - Intronic
906856965 1:49317769-49317791 AAATCTAACATCTTTAATACAGG + Intronic
907612178 1:55882540-55882562 AAGTATAACATATCTAAAAAAGG + Intergenic
908199085 1:61775712-61775734 AAATTTACCATGTATAATATTGG - Intronic
908327680 1:63039614-63039636 AAACTTACCATATCTAAAACTGG + Intergenic
909604862 1:77497880-77497902 AATCTTAAGATGTTTAAAACTGG - Intronic
910328270 1:86036988-86037010 AAAGTTAACATTTGTGAAACTGG - Intronic
910355410 1:86347198-86347220 ACATTTTTCATATCTAAAACAGG + Exonic
910390585 1:86739067-86739089 AAACTTAACATATTTAAAACTGG - Intronic
910422647 1:87083526-87083548 TATTTTAATATGTCTAAAACTGG - Intronic
910423418 1:87095183-87095205 ACATATAACATTTCTAAAGCTGG + Intronic
910874159 1:91862153-91862175 AGATTTAAAATGTCAAAAACAGG - Intronic
910909165 1:92215594-92215616 AAATTTGAGATGTCTATTACTGG + Intergenic
911588157 1:99714827-99714849 AGACTTAACATGTCCAAAATGGG - Intronic
911619783 1:100053600-100053622 AAAATTAATATGTCTAAAACTGG - Intronic
912057651 1:105625073-105625095 AATTATACCATGTCTAAAAATGG + Intergenic
912398787 1:109370870-109370892 AAATAGAACATGTCTATAAATGG + Intronic
913616007 1:120559681-120559703 AAATTTAGCATGATTAGAACTGG - Intergenic
914574271 1:148951217-148951239 AAATTTAGCATGATTAGAACTGG + Intronic
916189251 1:162163022-162163044 CCATTTAAAATGTCCAAAACAGG - Intronic
916347218 1:163807227-163807249 ATAATTAACATGTCTATAAATGG - Intergenic
916699417 1:167275689-167275711 AAATTTACCATTACTAAGACAGG - Intronic
917654124 1:177108740-177108762 AAATTTAACATGCCCCAAGCTGG - Intronic
917809335 1:178642319-178642341 GAAATTAGCATGTCTAAACCCGG + Intergenic
918149475 1:181785624-181785646 AAAATTAACATGGATAATACAGG - Intronic
918425683 1:184407338-184407360 ACATTTTACATGTCTAAAATGGG + Intronic
918598174 1:186318134-186318156 AATTTTCACATGACTTAAACTGG - Intronic
919188067 1:194180335-194180357 AATTTTAAAATGTGAAAAACTGG + Intergenic
919340849 1:196304523-196304545 ACATTTTACATGTATAAGACTGG + Intronic
919558413 1:199090906-199090928 AACTTTATCATGTGTAAAATGGG - Intergenic
920606988 1:207398705-207398727 AAATTTAACAAGACTAGAAGAGG - Intergenic
921595217 1:217047304-217047326 AAATTTGGCATGTCCAAAACTGG + Intronic
922010623 1:221581747-221581769 AAATGTAAAATGTGTAGAACAGG + Intergenic
922041148 1:221900014-221900036 ACATGTAAAATGCCTAAAACAGG - Intergenic
922299330 1:224282727-224282749 AAATCTACCACTTCTAAAACTGG + Intronic
922375953 1:224966280-224966302 AATTTTAAAAAGTGTAAAACTGG + Intronic
922547431 1:226468746-226468768 AAATTTAACCTCTCTGAAATTGG - Intergenic
923212330 1:231814912-231814934 CATTTTAACATCTCTGAAACAGG - Intronic
923900100 1:238316736-238316758 AAATGTAATATGTCTAACATTGG - Intergenic
924497502 1:244604353-244604375 AAATTTTAAATGTCAAAAAGTGG - Intronic
924510593 1:244726545-244726567 AAATTGAACATGTCAATCACGGG + Intergenic
924590264 1:245397195-245397217 AAAATGAACATGTGGAAAACAGG - Intronic
1063804100 10:9618086-9618108 AGATTTAATATTTCTAAAAAAGG + Intergenic
1064073203 10:12247752-12247774 AAAAGTAACATGTCCAAGACGGG + Intronic
1064487798 10:15814150-15814172 ATATTTAACAAATCTAAAACAGG + Intronic
1064702901 10:18040240-18040262 AAGTATAACATGTTTAAACCTGG + Intronic
1064885070 10:20102702-20102724 AAATTTACCATGCCTGAAACAGG - Intronic
1065669137 10:28094729-28094751 ATATTTAACATATTTAAATCTGG - Intronic
1067395266 10:45910022-45910044 AAATTAACCATGTCTATAAAGGG + Intergenic
1067863588 10:49879146-49879168 AAATTAACCATGTCTATAAAGGG + Intronic
1068558064 10:58481152-58481174 CAGTTTAACATCTCTGAAACTGG + Intergenic
1068694960 10:59957842-59957864 AAATTTAACAAAACTAATACAGG - Exonic
1069453881 10:68538499-68538521 AAATTTTCCATGCCTAAAACAGG - Intergenic
1070063545 10:73010485-73010507 AAATTTTTCATTTCTAAAATGGG - Intronic
1070947269 10:80403380-80403402 CATTTTAACATGTCTGAAATTGG + Intergenic
1071139514 10:82491538-82491560 AAAGTTAAGATGGCTAAAAAAGG - Intronic
1071578484 10:86748510-86748532 AAATTTAACATTTCAAATGCTGG + Intergenic
1071588025 10:86844673-86844695 TAATTATACATGTGTAAAACTGG + Intronic
1072096373 10:92185250-92185272 AAATGTAAGATTTCAAAAACTGG + Intronic
1072518370 10:96208976-96208998 AATTTAAATATGTCTAAAGCTGG - Intronic
1074065791 10:110012330-110012352 ACATTTAACATGTTTTCAACTGG - Intronic
1074096762 10:110320030-110320052 AAATTCAACATATTCAAAACGGG - Intergenic
1075191881 10:120316659-120316681 CATTTTAACATCTCTAAAATTGG + Intergenic
1075517861 10:123123447-123123469 ATATTTACCATTTCTAAAAATGG + Intergenic
1078339997 11:10491805-10491827 AAATTTAATATATCCAAAAGTGG - Intronic
1079031753 11:16991399-16991421 AAATATAACATGTCTGAGTCAGG + Intronic
1079471130 11:20778684-20778706 ATATTTCACATTTTTAAAACGGG - Intronic
1079486375 11:20939848-20939870 AAACTCAACATGCCTAAACCTGG - Intronic
1079780144 11:24591979-24592001 AAATATAACAGGTCTATTACAGG - Intronic
1080370271 11:31630637-31630659 TAATTTAAAATGAATAAAACTGG + Intronic
1080405513 11:31975364-31975386 AAATTCAACATTTTTAAAAATGG - Intronic
1080732714 11:34976430-34976452 AAATCTAACATGTGTAAAGTAGG - Intronic
1080772310 11:35353054-35353076 AGATTTAACATTTCTGAAATTGG + Intronic
1080934076 11:36843329-36843351 AGATTTAACAGGTCTAAAGTAGG + Intergenic
1082138677 11:48580579-48580601 AAATTTAAAATTTGCAAAACAGG - Intergenic
1082746820 11:56972038-56972060 AAATTTAAAGTTTCTAAAATAGG + Intergenic
1083184684 11:61010443-61010465 AACTTTAACACGTCTGAAATTGG - Intronic
1083345846 11:61991482-61991504 AAATTTAATTTGTTTGAAACAGG + Intergenic
1083790352 11:64980783-64980805 AAATTTAACATGGCCAAAATAGG + Intergenic
1085708785 11:78810626-78810648 AAAGTTAACAGGTCTGAATCAGG + Intronic
1085869203 11:80329476-80329498 AAATATAACATGGCTAGAAGTGG + Intergenic
1085968808 11:81562102-81562124 AACTTTAAGATGTCTAATCCTGG - Intergenic
1085969656 11:81572065-81572087 AATTTTAACACTTCTAAAACTGG + Intergenic
1086314562 11:85577523-85577545 AAACTTATCATGGCCAAAACTGG - Intronic
1086990545 11:93298932-93298954 AAATCTTATATGCCTAAAACTGG + Intergenic
1087234649 11:95704657-95704679 ATATTTTACAAATCTAAAACTGG + Intergenic
1087555132 11:99709600-99709622 AAATTTCACATTTCTAAATTGGG + Intronic
1087988661 11:104718536-104718558 CCATTTAAAATGTATAAAACTGG - Intergenic
1088014316 11:105039829-105039851 AAAATGAAGATGTCAAAAACTGG + Intergenic
1089272787 11:117313722-117313744 ACGTTTTACATGTATAAAACTGG - Intronic
1090293273 11:125565183-125565205 AAATTTAAGATGTTTAAACAGGG - Intergenic
1090641645 11:128734444-128734466 TAATTCAACCTGTTTAAAACAGG + Intronic
1090677351 11:129012108-129012130 AAATTTAAAATATTTAAAAAAGG + Intronic
1090687409 11:129138959-129138981 AAACCTACCATGTCTAAAACAGG + Intronic
1091974858 12:4816117-4816139 AAGCTTAGCATGTCTAAAAATGG + Intronic
1092533355 12:9363552-9363574 AAATTTTACATGGCTAAAAGTGG - Intergenic
1093351638 12:18109586-18109608 AAATTTAACATGTCTAAAACTGG - Intronic
1093533122 12:20190763-20190785 AAATATAACATTTTTAAAAAGGG - Intergenic
1093927586 12:24924464-24924486 AAACTTAACATGACTAATGCAGG + Intronic
1094029679 12:25996877-25996899 AAAGTTAACATGACTAGAACTGG - Intronic
1094187484 12:27660545-27660567 AAACATAACGTTTCTAAAACAGG - Intronic
1094259982 12:28483655-28483677 AAATTAAACGTGAATAAAACAGG + Intronic
1094332930 12:29315837-29315859 ACATTTAACAGCTCTAAAATTGG - Intronic
1094491228 12:30962115-30962137 CATTTTAACATCTCTAAAATTGG - Intronic
1095321037 12:40827383-40827405 AAATTAAACTTTTCTAAAAAAGG + Intronic
1095847822 12:46765415-46765437 TAATTTAGCATATCTAAAATAGG - Exonic
1096638990 12:52979330-52979352 AAATTTAACCTGTTCAAAACTGG + Intergenic
1096926107 12:55148333-55148355 AAATTTCCCATGGATAAAACTGG + Intergenic
1097655407 12:62355734-62355756 AAACTTAAGCTGTCTAAAAAGGG + Intronic
1098020972 12:66156251-66156273 AAACTTAACATGGCCAAAACTGG + Intronic
1098697609 12:73579468-73579490 TAATTCAACATGTCAGAAACTGG - Intergenic
1098752974 12:74319674-74319696 AAATTTAAAATGTGCATAACAGG + Intergenic
1098945925 12:76589551-76589573 AAATTTAATAAGTGTAAACCTGG - Intergenic
1099007489 12:77251405-77251427 AAATTAAAGATGACTAAAAATGG - Intergenic
1099543373 12:83944126-83944148 AAATTAAACTTTTCTAAAACAGG + Intergenic
1100509448 12:95255114-95255136 AGATTCAACTTGTCTAAAATAGG + Intronic
1102810402 12:115819349-115819371 ATCTTTAACATGTCTAAAATGGG + Intergenic
1105765979 13:23560013-23560035 AAATTAAACATTTTTAAAAGGGG + Intergenic
1106447197 13:29847089-29847111 AAATATAACATGACAAATACTGG - Intronic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107224288 13:38028432-38028454 AAATTCAATATCTCAAAAACTGG - Intergenic
1108969626 13:56356966-56356988 AAATTTATCAAGTGTAAAGCTGG - Intergenic
1109106567 13:58259357-58259379 ATATATAACCTGTGTAAAACTGG - Intergenic
1109448789 13:62481567-62481589 CAATTTAACATGTCTGAAATTGG - Intergenic
1109495791 13:63170130-63170152 AAATTGAAAGTGTCTAAAACAGG + Intergenic
1109833248 13:67821973-67821995 AAAATTAACATTTCAAGAACTGG - Intergenic
1110182735 13:72636587-72636609 ACTTTTAACATGTCTGCAACAGG - Intergenic
1110195798 13:72786993-72787015 CATTTTAACATCTCTAAAATTGG - Intronic
1110396081 13:75030520-75030542 AATTTTAATATTTCTAAAATTGG + Intergenic
1111058089 13:82975382-82975404 AAATATAACATGAATAAAAGAGG + Intergenic
1111090170 13:83435895-83435917 AAATTTATCAGGTCAAAAACAGG - Intergenic
1111110767 13:83706294-83706316 TTATTAAACATTTCTAAAACAGG + Intergenic
1111191786 13:84817957-84817979 ACATTTTAAAAGTCTAAAACTGG + Intergenic
1111248766 13:85576104-85576126 AAATTTATTATGTCCAAACCTGG + Intergenic
1111386957 13:87539846-87539868 AAATATCAGTTGTCTAAAACAGG + Intergenic
1111578896 13:90196909-90196931 AAATGTAACAATTCTAAAAGAGG + Intergenic
1112870742 13:103967963-103967985 AAATTTACCATGTCCAAAGGTGG - Intergenic
1113052710 13:106231620-106231642 AAACTTAAAATGTCTAAAACAGG - Intergenic
1113144319 13:107190500-107190522 ATATTTAACATTTTAAAAACTGG - Intronic
1114034803 14:18613381-18613403 ACATTTAACAGCTCTAAAATGGG - Intergenic
1114123839 14:19701635-19701657 ACATTTAACAGCTCTAAAATGGG + Intergenic
1115299946 14:31873958-31873980 AAATTTAAAATGTACAAAAAGGG + Intergenic
1115311034 14:31978228-31978250 AAAATTAACATAGCCAAAACTGG - Intergenic
1115913992 14:38289212-38289234 AGGTTTAACATGTGGAAAACTGG - Intergenic
1116071549 14:40052970-40052992 TAATAGAACATGTCTAAAATTGG - Intergenic
1116116946 14:40665606-40665628 AATGTTAACTTGTCTAAATCTGG - Intergenic
1116539267 14:46078489-46078511 AAAGTTAACATTACTAATACTGG - Intergenic
1118193097 14:63598409-63598431 CAATTTAAAATGTAAAAAACTGG + Exonic
1118549166 14:66930461-66930483 AAAAATAAAATGTTTAAAACTGG - Intronic
1118652498 14:67912404-67912426 AATGTTATCATGTCTAAAACAGG - Intronic
1118794941 14:69133769-69133791 ACTTTTAACATGTTTAAAATGGG - Intronic
1119057352 14:71436606-71436628 TAATTTAAAAGGTCTAAAACTGG - Intronic
1119577474 14:75739286-75739308 GAATTCAACATGTATAAAGCTGG - Intronic
1119623274 14:76149196-76149218 CAATTTAAAATGTCAAAAATAGG - Intergenic
1120317084 14:82908212-82908234 ATATTGAATATGTTTAAAACAGG + Intergenic
1120543985 14:85786870-85786892 CAATTATACATCTCTAAAACAGG + Intergenic
1120549698 14:85855040-85855062 AATTTTAACATCTCTGAAATTGG - Intergenic
1120865101 14:89289417-89289439 ACATTTAACATGTTCAAAATTGG + Intronic
1121068399 14:90992540-90992562 AAATTTCACATATATAAAATGGG + Intronic
1122185149 14:99986724-99986746 CAATTCAGCATGTCTACAACTGG + Intronic
1122224107 14:100263208-100263230 AAATTTAAAATGTGTACTACAGG - Intronic
1122463133 14:101912186-101912208 AAATTTAACATGTCCAAGATTGG - Intronic
1124243718 15:28052758-28052780 AAATTTAACATTTCTCAATTTGG - Intronic
1124282093 15:28371698-28371720 AAATTTATCTTCTCTAAAAGTGG + Intergenic
1124300608 15:28539920-28539942 AAATTTATCTTCTCTAAAAGTGG - Intergenic
1124605432 15:31166815-31166837 AAAATAAACATTTTTAAAACTGG - Intergenic
1125270436 15:37933114-37933136 AATTTTATGATGTCTCAAACTGG - Intronic
1125547312 15:40515660-40515682 AAAGTTAACATCTCTTAAATAGG - Intergenic
1125810039 15:42531139-42531161 TAGTTTAACATGCCTGAAACTGG - Intronic
1126522255 15:49608233-49608255 ACATTTACCTTGTTTAAAACAGG + Intronic
1126976607 15:54189205-54189227 AAAATTAAAATGTGTAAAAGTGG + Intronic
1127014282 15:54665826-54665848 AAATCTCAGTTGTCTAAAACAGG - Intergenic
1127391391 15:58507780-58507802 TATTTTAACATGTCTAGCACTGG + Intronic
1128397930 15:67247954-67247976 ATATTTTACATGTATAGAACTGG + Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1132288082 15:100680251-100680273 CATTTTAACATTTCTGAAACAGG + Intergenic
1133510009 16:6448891-6448913 AAATTTAAAATGACTGAAAATGG - Intronic
1133622938 16:7543575-7543597 AATTTTAATATGCCTAAGACTGG - Intronic
1133895983 16:9929302-9929324 TAATTTAACATGTCTAAAATTGG + Intronic
1135706175 16:24677091-24677113 AAATTCAACATGTCCAACTCTGG + Intergenic
1137933032 16:52606732-52606754 AAATTTAACATCTCTAAGGTTGG - Intergenic
1138058170 16:53858211-53858233 ATATTTAACATCTCTGAAATTGG + Intronic
1139037404 16:62963878-62963900 AAATTTCTCATTTGTAAAACCGG + Intergenic
1139251010 16:65496274-65496296 ATATTTATCATCTCTAAAATAGG - Intergenic
1140015626 16:71180012-71180034 AAAATTGACATGACAAAAACAGG + Intronic
1140334185 16:74088655-74088677 AAATTTAAAGAGTCTAAAAGAGG - Intergenic
1140620632 16:76726865-76726887 TAATTTAACATTTCTAGAATGGG + Intergenic
1140894601 16:79314070-79314092 CATTTTAACATTCCTAAAACGGG + Intergenic
1141209477 16:81963529-81963551 AAATTTAATAGATATAAAACTGG - Intergenic
1141285337 16:82666733-82666755 CCATTTAACATTTCTAAAAATGG - Intronic
1143314213 17:6019566-6019588 AAATTTAACATCACCAAAATTGG - Intronic
1144011055 17:11148770-11148792 TAAATTAACTTGTCTAAAAACGG - Intergenic
1144330205 17:14216364-14216386 AAATTTAGCTTGTCAAAAAAGGG + Intergenic
1144373967 17:14620513-14620535 AAAATTCACATGTATAAAAAAGG - Intergenic
1144377241 17:14656851-14656873 GAATTGAACATGGCTAAAGCTGG + Intergenic
1144528086 17:16008279-16008301 ATACTTAACATGTCCAAAATAGG + Intronic
1149243586 17:54679375-54679397 ACCTTTAATATGTCTACAACAGG + Intergenic
1149407204 17:56365483-56365505 AAATTTCTCATTTGTAAAACTGG - Intronic
1153480039 18:5538446-5538468 ACATTTAACATCTCTGAAATTGG - Intronic
1155055769 18:22181856-22181878 CATTTTCACATTTCTAAAACTGG - Intronic
1155335558 18:24761362-24761384 AAACTTACCATCTCTAACACAGG - Intergenic
1156926746 18:42590537-42590559 AAATTTAACTTGTTTATTACTGG + Intergenic
1157912279 18:51628114-51628136 AAAGTTAAAATGTCTGAAAGGGG - Intergenic
1158122651 18:54066585-54066607 AAATTTAACAAAACTAAAAGTGG + Intergenic
1159234636 18:65655796-65655818 AAAATTTATATGTCTAAAAATGG + Intergenic
1159344683 18:67185347-67185369 AAATATAACATTTCTTAAAATGG + Intergenic
1159382117 18:67674110-67674132 AAACTTAACATGTCCCAAACTGG + Intergenic
1159846033 18:73461092-73461114 AAATTTAGCATTTCAAATACAGG - Intergenic
1164878539 19:31711399-31711421 AGATTTAACATGTCCAACGCTGG + Intergenic
1164961823 19:32438357-32438379 AATTTTATCATTTCTAAAATGGG - Intronic
1165613367 19:37176698-37176720 ACATTTAACGAGTCTAGAACAGG + Intronic
1167982334 19:53285131-53285153 AAATTTAACCTGTATTAAAATGG + Intergenic
1167983810 19:53298842-53298864 AAATTTAACCTGTATTAAAATGG - Intergenic
1168473145 19:56657308-56657330 AATTTTACCTTGTCTAATACTGG + Intergenic
925121761 2:1423893-1423915 CACTTTAATATGTCTAAAATGGG + Intronic
925779030 2:7362993-7363015 AAATTTAAAAAGTATAAAACAGG - Intergenic
925938524 2:8791595-8791617 TAATTTAACATCTCTGAAATTGG - Intronic
926591391 2:14743728-14743750 TAATCAAACATGTCTAAAACAGG + Intergenic
926759763 2:16268026-16268048 CAAGTTAACATGTCTAATAAGGG - Intergenic
926945311 2:18181472-18181494 AAAATTAACATGGCCAAGACAGG + Intronic
926983910 2:18600160-18600182 CAACTTGACATGTCCAAAACTGG + Intergenic
927591137 2:24359732-24359754 AAATTTAACATTTCCAACTCCGG + Intronic
929132226 2:38588215-38588237 AAATTTACTAAGTCTATAACAGG - Intronic
930145851 2:48003509-48003531 AAATTTAACCTGTTTGAAATAGG + Intergenic
930793355 2:55358235-55358257 AGTTTTATCATGTCTAAAACTGG - Intronic
930921276 2:56757282-56757304 AAATTTAACATATGCAAGACTGG + Intergenic
931102404 2:59017249-59017271 AATTTTATCATGGCTAAAAATGG + Intergenic
931318445 2:61153591-61153613 AAATTTAAAATGTATAAACTGGG + Intronic
931478343 2:62613446-62613468 AACTTTTAAATGTTTAAAACTGG + Intergenic
933098839 2:78224170-78224192 TAATGTAACATTTCTTAAACTGG + Intergenic
933374361 2:81460582-81460604 AAAGTTGTCATGTATAAAACAGG + Intergenic
933509694 2:83224610-83224632 AAAAATAATATGTCTAAACCAGG + Intergenic
933551761 2:83786548-83786570 AATTTTAACATGTCTTAGAAAGG - Intergenic
934065201 2:88333969-88333991 AAATTTAATATGGCCAAAATGGG - Intergenic
934889316 2:98052748-98052770 AAATATTACATTTCAAAAACTGG + Intergenic
935030860 2:99320823-99320845 AAATATAAAATGTTTAAAATTGG + Intronic
935070995 2:99693455-99693477 AAATTTAAAATTTCTATAAATGG - Intronic
936406755 2:112211691-112211713 TTATTTAACATCTCTGAAACTGG - Exonic
936536322 2:113314231-113314253 AAATTTAAGATGACTAAATAGGG - Intergenic
936869890 2:117123918-117123940 AAATATAAAATCTCTAAAGCAGG + Intergenic
937162728 2:119780700-119780722 AAATTTAACATCACCAAAACTGG - Intronic
938276450 2:130029472-130029494 ACATTTAACAGCTCTAAAATGGG + Intergenic
938327407 2:130420230-130420252 ACATTTAACAGCTCTAAAATGGG + Intergenic
938362534 2:130701247-130701269 ACATTTAACAGCTCTAAAATGGG - Intergenic
938438922 2:131307887-131307909 ACATTTAACAGCTCTAAAATGGG - Intronic
938453108 2:131441520-131441542 AAACTTAATATGTCCAAAATGGG - Intergenic
938847529 2:135225466-135225488 CACTTTAACATCTCTGAAACTGG + Intronic
939519244 2:143208797-143208819 AGATTTAACATGTTATAAACAGG - Intronic
940278500 2:151964630-151964652 ATGTTTAACATGTCTAACACAGG - Intronic
940753228 2:157651637-157651659 AAATTTAAGATTTAAAAAACAGG + Intergenic
941195291 2:162443335-162443357 AAACTTAAGTTGGCTAAAACAGG + Intronic
941721273 2:168815821-168815843 AAAGTCAATATGTCTAAAACAGG + Intronic
942489223 2:176473363-176473385 AAGATTAACATGCCTGAAACTGG - Intergenic
943113747 2:183640116-183640138 AAATTTATTATGTCTAAAAGTGG - Intergenic
943389615 2:187248303-187248325 AAATTTAAAATGTATTAAAGTGG - Intergenic
943844705 2:192630541-192630563 AAATTCAACATGTTCAAATCTGG - Intergenic
944123250 2:196264644-196264666 AAATTTAAAAGGCCCAAAACAGG - Intronic
944399221 2:199306029-199306051 ATTTTTAAGATTTCTAAAACAGG + Intronic
944678772 2:202056750-202056772 CATTTTAACATTTCTAAAATTGG + Intergenic
944704070 2:202271200-202271222 ATATTTAACATCCCTAAAATTGG + Intronic
945220334 2:207477093-207477115 ACATTTAAAATGATTAAAACAGG + Intergenic
945956573 2:216091810-216091832 CAATTGAACAGGTTTAAAACTGG + Intronic
946917970 2:224545916-224545938 AAATTTGACATTTTTAAAAAAGG + Intronic
947131457 2:226930797-226930819 AAAATAAACCTGTCAAAAACTGG + Intronic
947186501 2:227460048-227460070 AAATGTAACCTGTATAAAAAAGG + Intergenic
948029964 2:234809446-234809468 ACATTTAACATGGCCAAAGCAGG + Intergenic
1169808720 20:9586438-9586460 AAAATTTACATGTCAAAAAGAGG + Intronic
1169885822 20:10396112-10396134 ACATTTAACTTTTCTAAAATTGG - Intergenic
1170027938 20:11911202-11911224 CACTTTAACATCTCTGAAACTGG - Intronic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1170414463 20:16125215-16125237 AAATTTAATAAGTCTAGAAAAGG + Intergenic
1170769972 20:19324168-19324190 AGATTTCACATGACTGAAACAGG - Intronic
1170931122 20:20770279-20770301 AAGTTTAACATGTCTCTAAAAGG - Intergenic
1172335267 20:34110991-34111013 AAATTTTTCATCTCTAAAATGGG + Intronic
1173240220 20:41288956-41288978 TTAATTAGCATGTCTAAAACTGG - Intronic
1174909448 20:54591344-54591366 AAATTTAAAAATTCTAAAAATGG + Intronic
1175122842 20:56729656-56729678 AAATATTTCATGTCTAAAAAGGG + Intergenic
1176979880 21:15369202-15369224 TTATATAACATGTCTAGAACAGG - Intergenic
1177080486 21:16633106-16633128 AAATTTAAGATATTGAAAACTGG - Intergenic
1177175948 21:17700777-17700799 TGATTTAACATGTCTCAAAATGG - Intergenic
1177329883 21:19644842-19644864 ACACCTAACATTTCTAAAACAGG - Intergenic
1177863161 21:26478974-26478996 AAATTTGACATGTCTAAACTTGG - Intronic
1177869402 21:26552788-26552810 ATATTTAACATGACTAGCACAGG - Intronic
1177902046 21:26928473-26928495 AAATTTAGCAATTTTAAAACTGG + Intronic
1179136788 21:38686666-38686688 AAATTTGACATTTCTAAACTGGG + Intergenic
1179368444 21:40781318-40781340 AAATTTAAAATGTACAAAATGGG - Intronic
1180458923 22:15540429-15540451 ACATTTAACAGCTCTAAAATGGG - Intergenic
1181271142 22:21659184-21659206 AAAGTAAACATGTACAAAACTGG + Intronic
1182761330 22:32724715-32724737 AATTTTGACATGTCTAGAAATGG + Intronic
1182993105 22:34786883-34786905 AAACTTAAAATGTTCAAAACTGG - Intergenic
1183139421 22:35922583-35922605 AAACTAGACATGTCTAAATCAGG + Intronic
1184102908 22:42350692-42350714 TCATTTAAAATGTCCAAAACTGG + Intergenic
949219455 3:1613098-1613120 AAATATCACAGGTCTATAACTGG + Intergenic
949309507 3:2680784-2680806 TATTTTTACATGTATAAAACTGG - Intronic
949752346 3:7368864-7368886 AAATTCAACATGTTTGTAACAGG - Intronic
950119810 3:10474277-10474299 AAAGTTAACAAGTCCAAAACAGG - Intronic
950916115 3:16646921-16646943 AAAATTAATGTGTCTGAAACTGG - Intronic
951495648 3:23322374-23322396 GAGTTCAAGATGTCTAAAACTGG + Intronic
951604211 3:24414295-24414317 AAATTTGACATGCTTAACACTGG - Intronic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952001966 3:28796416-28796438 AAATTCACCTTGTCCAAAACTGG - Intergenic
952216808 3:31286082-31286104 AAATTTAACTGGTCTGAAAGAGG + Intergenic
952225599 3:31372412-31372434 AAATTCGACATATCTGAAACTGG - Intergenic
952368085 3:32692532-32692554 AAATTTAGCATCACTAATACTGG - Intronic
952598596 3:35050255-35050277 AAATTTTAAGTGTCTTAAACAGG + Intergenic
952876444 3:37948743-37948765 ATATTTAACATGTTTAATAATGG + Intronic
952923475 3:38304887-38304909 AGATTTAACATGTATCAAATTGG - Intronic
953041037 3:39254980-39255002 TATTTAAACATGTCTAAAAAAGG - Intergenic
953314063 3:41909408-41909430 AAATTTAAAATGTATAAAATGGG + Intronic
953483500 3:43272903-43272925 AATTTTTACATCTCTAAAAATGG - Intergenic
953580898 3:44155432-44155454 CAATTTAAAATGTCCAAAGCTGG - Intergenic
953600224 3:44355832-44355854 AAATTTTACATATCTAAAAAAGG - Intronic
953671643 3:44967795-44967817 AATTTTCACATTTGTAAAACAGG - Intronic
953725983 3:45399325-45399347 AGATGTAACATCTCTAAAAATGG - Intronic
955155459 3:56412697-56412719 AAATTTCTCATCTGTAAAACAGG + Intronic
956613630 3:71149378-71149400 CATTTTAACATCTCTAAAATTGG + Intronic
957207597 3:77217493-77217515 AAATGTTACATGGCTAAATCAGG - Intronic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
958476287 3:94587707-94587729 AAATTTACCATTTGTGAAACTGG - Intergenic
958904112 3:99923339-99923361 ATACTCAACATGTCTAAACCAGG + Intronic
958964055 3:100538269-100538291 AAAGTTTAAATTTCTAAAACTGG + Intronic
959038503 3:101393228-101393250 AAATGTAAAATTTCCAAAACAGG + Intronic
959243878 3:103837545-103837567 AAATTTTACATGTCAAAGGCAGG + Intergenic
959804430 3:110533789-110533811 AAATTTTACATGTCAAAAGCAGG - Intergenic
961395252 3:126582712-126582734 AAATTAAACCTGTCCAAAAACGG + Intronic
962597542 3:136961877-136961899 AAAAATAACATGAGTAAAACGGG + Intronic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
964875148 3:161358680-161358702 AAAAATAACCTCTCTAAAACTGG - Intronic
965513084 3:169590788-169590810 ATATTTAACAAGTATTAAACTGG + Intronic
966140906 3:176754349-176754371 ATATTTAATTTGTCTAAAAAAGG - Intergenic
966149078 3:176846735-176846757 TAATTTATCTTCTCTAAAACTGG + Intergenic
966427198 3:179792240-179792262 AAACTTAACACATCTTAAACTGG - Intergenic
966493555 3:180555270-180555292 AAAGTTCACATGTTTCAAACTGG + Intergenic
966688152 3:182718467-182718489 AAATTTAACCTCTCTTGAACAGG - Intergenic
967229577 3:187324714-187324736 AAGCTTAACATGTCCCAAACTGG - Intergenic
967279427 3:187807822-187807844 ATATTTATTATGTCTAAAATGGG - Intergenic
967545565 3:190722788-190722810 AAATTTGACATAAATAAAACAGG - Intergenic
967585281 3:191206259-191206281 ACATTTAACATCTCTGAAATTGG + Intronic
967606498 3:191452772-191452794 AGCTTTAACATTTCTAAAACTGG - Intergenic
967626041 3:191684993-191685015 AAATTGATCATCTCTAAAAGTGG - Intergenic
967899941 3:194439631-194439653 TATCTTAACATCTCTAAAACTGG + Intronic
969137768 4:5044394-5044416 AAATTTAACATGTCCCAGAGGGG + Intergenic
970047293 4:11869373-11869395 ACATTTAACATGGTTAAAGCAGG + Intergenic
970306698 4:14740003-14740025 AAATGTAACATGTCTGATGCTGG - Intergenic
970712663 4:18881654-18881676 ATATTCAACATGCCAAAAACAGG + Intergenic
971665399 4:29477543-29477565 AAATTTAATATGGCTAACATTGG - Intergenic
971823281 4:31587274-31587296 AAATGTTACATGTCTGAAATTGG - Intergenic
972128307 4:35798953-35798975 AAATTTTACATGACTATAAAGGG - Intergenic
972717234 4:41658624-41658646 CATTTTAACATCTCTAAATCAGG + Intronic
972845897 4:42988982-42989004 AACTTTCACATGTATAAAAGGGG + Intronic
973332627 4:48924679-48924701 AAATTTAAAATGTCAAAGCCAGG - Intergenic
973755711 4:54071448-54071470 AGTTTTATAATGTCTAAAACAGG - Intronic
973772100 4:54216652-54216674 CAAATTAAAATGTCTAAAATTGG - Intronic
973811298 4:54572760-54572782 TAGTTTAACTTGACTAAAACAGG - Intergenic
973915162 4:55626389-55626411 ATATTGACAATGTCTAAAACTGG - Intronic
974136784 4:57827874-57827896 AAAGTTAGAATGTTTAAAACAGG - Intergenic
974698519 4:65406771-65406793 AAAATTAACATGTTTAAAATTGG + Intronic
974820507 4:67061562-67061584 AAATTAAAGATGAATAAAACAGG - Intergenic
974976406 4:68898641-68898663 AAATTTAACTTGTGTAGTACAGG + Intergenic
975033173 4:69649475-69649497 ATATTTTAGTTGTCTAAAACTGG - Intronic
975292969 4:72698470-72698492 AAATTCTACAGGTCCAAAACAGG - Intergenic
975637699 4:76466790-76466812 AAATTAAACATGTACAAAAAAGG - Intronic
975684573 4:76906802-76906824 AAATATAACATTTCCAAAATGGG - Intergenic
975842952 4:78495222-78495244 ATACCTAAAATGTCTAAAACTGG - Intronic
976754559 4:88483940-88483962 AAGTCTAACATGTCAATAACTGG - Intronic
977751915 4:100620148-100620170 AACTTTAACAGGTCATAAACTGG + Intronic
977935117 4:102793026-102793048 TCTTTTAAAATGTCTAAAACTGG - Intergenic
978224224 4:106315384-106315406 AAATTTCACATTTCTTCAACAGG + Intronic
978243596 4:106546316-106546338 AAATTTTACATTTTTAAAGCAGG + Intergenic
978285339 4:107071750-107071772 CAATTGAACATGTCTAAAGATGG + Intronic
978788238 4:112634068-112634090 ATATTTTATATGTCTAAAAGAGG - Intronic
979116937 4:116836369-116836391 ATATTTAAGATGTGTAAAGCTGG + Intergenic
979234950 4:118389165-118389187 TAATGAAACATTTCTAAAACAGG - Intergenic
979282489 4:118883168-118883190 AAATTTAAAATGGCAAAACCAGG - Intronic
980383708 4:132059715-132059737 TAATTTAATATGTATAAAAATGG + Intergenic
980509164 4:133762035-133762057 AAATTTATAATTTATAAAACTGG + Intergenic
981386131 4:144132664-144132686 AAAATTAAGTTGTATAAAACAGG + Intronic
981569766 4:146139092-146139114 AAATTTAACATGATCAAAACTGG + Intergenic
982061386 4:151607396-151607418 TAATTTAGTCTGTCTAAAACTGG - Intronic
982200871 4:152958820-152958842 AAATTTAATAAGGCTAAAAATGG + Intronic
982322391 4:154092465-154092487 ACATTTAACAGTTATAAAACAGG - Intergenic
983073449 4:163296227-163296249 AAAATTAACATTTCTTAAATTGG + Intergenic
983769303 4:171528930-171528952 CAGTTGAACATGTATAAAACTGG + Intergenic
985009837 4:185570759-185570781 AAAATTAAATTGTCTTAAACTGG + Intergenic
987361937 5:17115316-17115338 AAAATTAGCAGGTCTGAAACAGG - Intronic
988792924 5:34625033-34625055 CATTGTAACATCTCTAAAACTGG + Intergenic
988861767 5:35288533-35288555 AAATTTAAAATTTATAAAAAGGG - Intergenic
989042856 5:37247569-37247591 ACATATAACATATATAAAACTGG + Intronic
989271432 5:39538073-39538095 AAACTTAACATGTCCCAAATTGG - Intergenic
989800307 5:45529989-45530011 AAATTAAATATGTGAAAAACAGG - Intronic
991238454 5:64427185-64427207 AAATTTAAAATTTAAAAAACAGG + Intergenic
991297470 5:65096388-65096410 AAATTTAAGAACTCAAAAACAGG + Intergenic
992078789 5:73215587-73215609 AAATATAACGTGTCTAAAAATGG - Intergenic
992364893 5:76081935-76081957 AAATGTTACATGTATAATACAGG - Intergenic
992647498 5:78825834-78825856 AAATTTAAAATGACTTAAAGAGG - Intronic
993100741 5:83536786-83536808 CAATTTAACATTATTAAAACAGG - Intronic
993106070 5:83602369-83602391 AAACTTAACAGGTCTAAAACTGG + Intergenic
993181007 5:84551762-84551784 ACATTAAACATTTCTAAAAATGG - Intergenic
993184801 5:84603743-84603765 GAATTTAGCATTTCCAAAACAGG + Intergenic
993661478 5:90642281-90642303 AAATTAAATTTTTCTAAAACTGG + Intronic
994397571 5:99238153-99238175 AAACTTCACAAGTCTCAAACTGG - Intergenic
994739363 5:103598793-103598815 AAATTAAACATGCCTAAAACTGG - Intergenic
995078862 5:108022230-108022252 AACTTTTCCATGTCTAAAACAGG + Intronic
995447026 5:112255846-112255868 AAATTCAACATGTTCAAAACGGG + Intronic
995885472 5:116889403-116889425 AGATTTAACAGGTCTAGAATGGG + Intergenic
996065321 5:119072604-119072626 AAATTTAACACTCCTAAACCTGG - Intronic
996889126 5:128396263-128396285 AAATATAACATGTTTTAAAGAGG - Intronic
996949204 5:129105268-129105290 TGATTTAACAGGTGTAAAACTGG + Exonic
996971575 5:129375309-129375331 AAGTTTAACATCTATAAAATAGG - Intergenic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
997597135 5:135114595-135114617 AGTTTTCACATGTGTAAAACTGG + Intronic
998749291 5:145300152-145300174 AAATTTGAAATGGCTAGAACTGG - Intergenic
1000132741 5:158315597-158315619 TATTTCAACATGTCAAAAACTGG - Intergenic
1000151927 5:158511324-158511346 ATATTTAACATCTCTGAAATTGG + Intergenic
1000493354 5:161944825-161944847 AAATTTAAAATGACTATAATTGG - Intergenic
1001248700 5:170127271-170127293 AGGTTTAACATGTGTATAACTGG + Intergenic
1001866058 5:175106516-175106538 AAATATTGAATGTCTAAAACAGG - Intergenic
1002824388 6:760018-760040 AAATCTAAAATGTATAGAACAGG - Intergenic
1003011698 6:2433138-2433160 AAATTTCATATTTCTAAAAGTGG + Intergenic
1004046774 6:12032658-12032680 AAATATAACATAGATAAAACTGG + Intronic
1004402937 6:15305434-15305456 AAATTTAGCGTGGCGAAAACTGG - Intronic
1004635975 6:17468111-17468133 AAATTCAACATGGATAGAACTGG - Intronic
1004762908 6:18690438-18690460 AAATTTCTCATTTCTAAAGCTGG - Intergenic
1005120057 6:22379803-22379825 TAATTTAGAATGTCTGAAACAGG + Intergenic
1007016538 6:38473410-38473432 AAATTCCACATGCCTAAAATTGG + Intronic
1007921720 6:45616256-45616278 AATTTTAACTTTTTTAAAACAGG - Intronic
1008721587 6:54360416-54360438 CATTTTAACATCTCTAAAATTGG - Intronic
1008729361 6:54461461-54461483 AAAATTCACAAGTCTAAAATAGG - Intergenic
1009029450 6:58038828-58038850 AAATATGACATATCTAGAACTGG - Intergenic
1009204986 6:60790218-60790240 AAATATGACATATCTAGAACTGG - Intergenic
1009335749 6:62489020-62489042 ATATTTAACAAGTTTTAAACAGG - Intergenic
1009892175 6:69698913-69698935 ATATTTAATATTGCTAAAACTGG - Intronic
1010002488 6:70961834-70961856 AAAATTAAAATATGTAAAACAGG + Intergenic
1010138076 6:72578420-72578442 ACATTTCACATGTGTAAATCTGG - Intergenic
1011059720 6:83251033-83251055 CAATGTAATATGTCTAAAGCAGG - Intronic
1011222783 6:85074053-85074075 ATATTTTACATGTATTAAACAGG + Intergenic
1011635001 6:89363357-89363379 AAATCTAATATGTCTAAAATTGG - Intergenic
1011900005 6:92281728-92281750 TATTTTTACATGTCTAAATCAGG + Intergenic
1011963312 6:93119701-93119723 AAAATTAACATGTCCAATAATGG - Intergenic
1012109259 6:95205536-95205558 AAACTTAAAATGTCCAAAAAAGG - Intergenic
1012177632 6:96108404-96108426 ACATTTCTCATCTCTAAAACTGG + Intronic
1012201634 6:96413397-96413419 AAACCTAACATGCCTAAAGCAGG + Intergenic
1012579234 6:100844882-100844904 ATCTTAAACAGGTCTAAAACAGG + Intronic
1013029569 6:106320047-106320069 AAATTTATCATTTGTAAAATGGG - Intronic
1013423214 6:109985588-109985610 AAATTTAACACATTTAAAATTGG + Intergenic
1013675248 6:112452855-112452877 AAAAAAAACAAGTCTAAAACTGG - Intergenic
1014083145 6:117311468-117311490 AAATTTCTCATGTGTAAAATGGG + Intronic
1014574421 6:123052803-123052825 AAATTTAACGTGTTCAAAATTGG - Intronic
1014909435 6:127072612-127072634 AATTTAAACATTTCTAAAGCAGG - Intergenic
1015188822 6:130450452-130450474 AAATTTATCATAGCCAAAACTGG + Intergenic
1015210005 6:130686208-130686230 AAAGATAGCATGTCTGAAACTGG - Intergenic
1015322366 6:131890452-131890474 AACTTTAAAATGTCTGAAACTGG - Exonic
1015833455 6:137394254-137394276 GAAATTTAAATGTCTAAAACAGG - Intergenic
1016657422 6:146537603-146537625 TAATTTAAGATGTCAACAACAGG + Intergenic
1016711996 6:147184416-147184438 AAATTTAAAATAAATAAAACAGG + Intergenic
1016929548 6:149390262-149390284 CAATTTTACATGTCTAAATCAGG - Intronic
1017001069 6:149998113-149998135 TAATTTAAAATTTCTACAACAGG + Intergenic
1017105743 6:150886019-150886041 AAATTGAGCATGTTTAAAACAGG - Intronic
1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG + Intergenic
1018611315 6:165650291-165650313 AAAATCAAAATGTATAAAACGGG + Intronic
1021584874 7:22197298-22197320 AAATCAAACCTGTCTGAAACAGG + Intronic
1021707040 7:23378127-23378149 AAATTAAAAATGTTTAAAACAGG + Intronic
1021855190 7:24848350-24848372 AAATTTAGCATATCTGAAGCAGG + Intronic
1022165568 7:27757212-27757234 AAATTGGAGATGTTTAAAACAGG - Intronic
1022337670 7:29437296-29437318 GCATTTAAGATATCTAAAACCGG + Intronic
1022435752 7:30383186-30383208 ATATTAAACATGTCAAAAAAAGG - Intronic
1024886644 7:54149534-54149556 AAATTTAACATGTCTGAAACTGG - Intergenic
1025864729 7:65370718-65370740 AAATTTAATATCTCTAAAGTTGG + Intergenic
1026473558 7:70714873-70714895 AATTTTGACATCACTAAAACTGG - Intronic
1026615569 7:71900058-71900080 AACTTTATCATGTCAAAAATAGG + Intronic
1027809309 7:82873474-82873496 ATGTTTAAAATGCCTAAAACTGG - Intronic
1028226451 7:88257605-88257627 ATATTCCACATGTCTAAACCTGG + Intergenic
1028928370 7:96385766-96385788 AAATATTACATGGCTAAAACTGG + Intergenic
1029882209 7:103826646-103826668 AAATTTCACACTTCTAAAACTGG + Intronic
1030181997 7:106719734-106719756 CATGTTAACATGTCTAAAATTGG - Intergenic
1030364467 7:108629720-108629742 AAATTTAAAATATCTAGAATAGG + Intergenic
1030419951 7:109296539-109296561 GAATTCAATATATCTAAAACGGG - Intergenic
1030465220 7:109892988-109893010 AAATTTAACATGCCAATTACTGG - Intergenic
1031058629 7:117023608-117023630 AAGTTTCCCATGTCTAAAAATGG + Intronic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1031663411 7:124455393-124455415 TAATTTAGCATGTATAACACTGG + Intergenic
1032504789 7:132426858-132426880 AAATTTAACTTGTCTCTAAGGGG + Intronic
1032533564 7:132641937-132641959 ACATTTAACATTTCTGAAAGGGG - Intronic
1032870468 7:135979149-135979171 AAACTTAACATGTCCAGAATAGG + Intergenic
1034325796 7:150230971-150230993 AAATTGATAATATCTAAAACAGG - Intergenic
1037615064 8:20511670-20511692 AATTTTCACATTTCTAAAATAGG + Intergenic
1038468723 8:27791788-27791810 AAATAAAAGATGCCTAAAACAGG - Intronic
1038711228 8:29948126-29948148 ATATTTAACATGTTCAAATCAGG + Intergenic
1038787044 8:30627526-30627548 AAATTTAAGATGTCTTGAATGGG + Intronic
1039655320 8:39398734-39398756 AAATTTATCATTTTTAAAAAGGG + Intergenic
1041949215 8:63481711-63481733 ATATTTAACATGTCAAAGAGAGG - Intergenic
1042507253 8:69573775-69573797 AAATGCAACATTTCTAAAATGGG + Intronic
1042667055 8:71218621-71218643 GAATTTAACATTTTAAAAACAGG + Intronic
1043308381 8:78825845-78825867 AAATTGAATATGTCTAAAAGGGG - Intergenic
1043730963 8:83680950-83680972 AATAGTAAAATGTCTAAAACAGG - Intergenic
1043878548 8:85514913-85514935 AACTTTAACATGTCTCAAGGAGG - Intergenic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1045065695 8:98441978-98442000 AAATTCAACATGTCCAATTCTGG + Intronic
1046389874 8:113556678-113556700 AAATTTGACAAGTCTAAAATAGG + Intergenic
1047420614 8:124705051-124705073 AAATTTAACATGTGTAGGAAGGG - Intronic
1047541892 8:125775819-125775841 AAACTGAAAATGACTAAAACTGG + Intergenic
1047606034 8:126475463-126475485 AAATTTAGCATTTTGAAAACAGG + Intergenic
1047679372 8:127238464-127238486 AAATTTATAAAGTCAAAAACTGG - Intergenic
1047787389 8:128167230-128167252 AAGTTAAACATTTCTATAACAGG + Intergenic
1047906790 8:129481116-129481138 AAATTTAACTTATGTAAGACAGG + Intergenic
1047950240 8:129926899-129926921 AAACTTTAAATGCCTAAAACTGG + Intronic
1048160468 8:132016250-132016272 AAATTTAACACATCCAAAACAGG - Intergenic
1048335521 8:133499462-133499484 AAATTTAGCATTTTTACAACAGG - Intronic
1050315149 9:4393785-4393807 AAAGTTAACATTACTAAAAATGG - Intergenic
1050709338 9:8442166-8442188 TAATTTAAAATGTTAAAAACTGG + Intronic
1050910439 9:11062330-11062352 AAGTTATACATGTATAAAACTGG + Intergenic
1051222392 9:14863368-14863390 ATATTTAATATGTTTAAAAATGG + Intronic
1051915189 9:22199285-22199307 AAATAAAACATGTCTGAGACTGG - Intergenic
1052482714 9:29051851-29051873 AAATTTTTCATCTCTAAAATGGG + Intergenic
1052676853 9:31637282-31637304 AATTTTATCATCTGTAAAACAGG - Intergenic
1052937802 9:34107599-34107621 AAATTTAACGTGGCCAATACAGG + Intronic
1054892996 9:70272340-70272362 CATTTTAACATCTCTGAAACTGG - Intronic
1055020594 9:71665279-71665301 ACATTTAACATCTCTGAAATTGG + Intergenic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1056052728 9:82786662-82786684 AAATTTCTCATCTATAAAACAGG - Intergenic
1057464698 9:95302148-95302170 AAATTAAACATGTTTAATTCAGG - Intronic
1057709859 9:97429909-97429931 ACATTTAAAATGTCCAAAACAGG - Intronic
1057799683 9:98182830-98182852 CATTTTAACATCTCTGAAACTGG + Intronic
1058007932 9:99939550-99939572 CATTTTAACATCTCTAAAATTGG - Intronic
1060245355 9:121941455-121941477 AAAGTCAACCTGTCTAAAACTGG + Intronic
1185999327 X:4990081-4990103 AAATTTTCCATGTGCAAAACGGG - Intergenic
1186798822 X:13072538-13072560 AAATTAGCCATGTCTAAAAGAGG + Intergenic
1187047113 X:15657752-15657774 AATTTTAAGATCTATAAAACAGG + Intronic
1187259179 X:17669577-17669599 AAATTTAATATATCCAAAAGAGG + Intronic
1187691410 X:21871703-21871725 AAAAATAACATTTCAAAAACAGG - Intronic
1188250904 X:27892978-27893000 AGTTTTATCATTTCTAAAACTGG - Intergenic
1188671362 X:32886193-32886215 AAATTTAATATCTCAAAAGCAGG + Intronic
1188849903 X:35118988-35119010 AAATCTTACATGTGTATAACAGG - Intergenic
1189172155 X:38919347-38919369 CAAATTAACATGCCTAAAATTGG - Intergenic
1189256886 X:39646936-39646958 AAATGTAAAATGTGAAAAACAGG + Intergenic
1190035611 X:47020417-47020439 ATATATAACATGGCTAAAGCTGG - Intronic
1190118752 X:47643249-47643271 AATTTTCTCATGTGTAAAACAGG + Intronic
1190447065 X:50536668-50536690 AAATTCAACATCTGCAAAACTGG - Intergenic
1193898009 X:87138001-87138023 AAAATTAACATGTGAAAATCAGG + Intergenic
1193958138 X:87888248-87888270 AAATGTAACATGGCTAAATAAGG + Intergenic
1194143446 X:90234335-90234357 CAATTTATCATGTCTTAAAATGG + Intergenic
1194582051 X:95686039-95686061 AAAATTAACTTATTTAAAACAGG - Intergenic
1194636579 X:96351774-96351796 TAATTTAAAATATCTAAATCTGG + Intergenic
1195389345 X:104344951-104344973 AAACGTAACATGTATAAAGCAGG - Intergenic
1195513307 X:105742829-105742851 AAATTTAGCTTGTCCCAAACAGG + Intronic
1195670213 X:107463263-107463285 ATTTTTAACATTTCTGAAACTGG + Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1197367912 X:125588903-125588925 AAATTTAAGAAGTGAAAAACTGG + Intergenic
1197375842 X:125681289-125681311 AAATTTATAATCTTTAAAACTGG + Intergenic
1197445598 X:126549820-126549842 ATATTTGTCATTTCTAAAACTGG - Exonic
1198140691 X:133799629-133799651 AAATTTATCATGTAAAAAACAGG - Intronic
1199387138 X:147236259-147236281 AAATTCAACATATCTATAAAAGG - Intergenic
1199473044 X:148216290-148216312 AAATTTTACATATCAATAACAGG + Intergenic
1199577391 X:149325922-149325944 AAATATAACATGCTTAGAACTGG + Intergenic
1199718202 X:150522602-150522624 AAAATTCCCATGTCCAAAACAGG + Intergenic
1199800285 X:151244124-151244146 ATCTGTAACATGTCTAAAAAAGG - Intergenic
1200489200 Y:3803656-3803678 CAATTTATCATGTCTTAAAATGG + Intergenic
1202131579 Y:21617098-21617120 ACATTAATCATGTCAAAAACTGG - Intergenic