ID: 1093353615

View in Genome Browser
Species Human (GRCh38)
Location 12:18135080-18135102
Sequence GGTCTGAGGAGACAACAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093353607_1093353615 29 Left 1093353607 12:18135028-18135050 CCTTCCAGTTTGTTCCATTCTAG 0: 1
1: 0
2: 1
3: 19
4: 232
Right 1093353615 12:18135080-18135102 GGTCTGAGGAGACAACAGGTTGG 0: 1
1: 0
2: 3
3: 19
4: 191
1093353610_1093353615 15 Left 1093353610 12:18135042-18135064 CCATTCTAGTGGCACAAACAGAG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1093353615 12:18135080-18135102 GGTCTGAGGAGACAACAGGTTGG 0: 1
1: 0
2: 3
3: 19
4: 191
1093353609_1093353615 25 Left 1093353609 12:18135032-18135054 CCAGTTTGTTCCATTCTAGTGGC 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1093353615 12:18135080-18135102 GGTCTGAGGAGACAACAGGTTGG 0: 1
1: 0
2: 3
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093353615 Original CRISPR GGTCTGAGGAGACAACAGGT TGG Intronic
901688311 1:10956901-10956923 GGACTGAGGAGAGGAGAGGTGGG + Intronic
902458079 1:16550543-16550565 GGTCTGTGGAAAAGACAGGTAGG - Intergenic
902494079 1:16857376-16857398 GGTCTGTGGAAAAGACAGGTAGG + Intronic
902689120 1:18098706-18098728 GGTCTGGGGACACAGCAGGAGGG + Intergenic
903151265 1:21411302-21411324 GGTCTGTGGAAAAGACAGGTAGG - Intergenic
903262151 1:22137138-22137160 GGTCTGAGGAGAGAGCGGGAGGG - Intronic
903641661 1:24864157-24864179 GTTCTGAGGAGAACAGAGGTGGG - Intergenic
905279410 1:36839393-36839415 CCTCAGAGGAGACAACTGGTGGG - Intronic
907266194 1:53262945-53262967 GGCCTGAGGAGACAAAAGCAGGG - Intronic
910494581 1:87812365-87812387 GGGCTGAGGAGAAAATTGGTAGG + Intergenic
911788244 1:101979214-101979236 GGGCAGAGTAGACAGCAGGTGGG - Intronic
913065927 1:115254781-115254803 ATTCTAAGGAGACAACAGGCTGG + Intergenic
914815291 1:151058534-151058556 GGGCTGAGAAAACAACAGGAGGG + Exonic
915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG + Intronic
915345998 1:155197257-155197279 AGTGAGGGGAGACAACAGGTCGG + Intronic
915838705 1:159198584-159198606 AGCCTGAGGAGACATAAGGTAGG + Intronic
916195951 1:162222990-162223012 GAGCTGAAGTGACAACAGGTGGG - Intronic
916851624 1:168710389-168710411 GGTCTGTGGAGCCAAAAGGTGGG - Intronic
917958375 1:180123641-180123663 GGTGTGATGATGCAACAGGTCGG - Intergenic
918752013 1:188284778-188284800 GGTATGAGCAGAAAACAGGAAGG - Intergenic
924738800 1:246782497-246782519 GGCCTGAGGAGGAAACAGGTCGG + Intergenic
1063466725 10:6250709-6250731 GATCTGAGGACACAGCAGGAAGG + Intergenic
1069767441 10:70873683-70873705 TATCGCAGGAGACAACAGGTGGG - Intronic
1071052970 10:81473618-81473640 GCTCTCAGGAGACAAAAAGTGGG - Intergenic
1072410240 10:95195451-95195473 GTTATGAGGAGAAAACAGGCAGG + Intronic
1074105917 10:110389587-110389609 GCTCTGAGGAGACAACATTCAGG + Intergenic
1075257371 10:120936100-120936122 GGTCTGAGGAGAGATAATGTGGG - Intergenic
1075657219 10:124169903-124169925 GGGCTGAGGGTACCACAGGTGGG - Intergenic
1075731982 10:124641759-124641781 GGTCCCAGGTGTCAACAGGTGGG + Intronic
1076607014 10:131695704-131695726 GGTCTGAGGAGACAGCTGCCAGG + Intergenic
1077418201 11:2435812-2435834 GGAGAGAGGAGAAAACAGGTGGG - Intergenic
1077578591 11:3402778-3402800 GGGGTGAGGAGAACACAGGTTGG - Intergenic
1079328883 11:19517740-19517762 GGTCTTAGGGGACACCAGGGTGG - Intronic
1081676140 11:44970857-44970879 GGTCTGAGGAGACTAAAGCATGG - Intergenic
1082941514 11:58710022-58710044 GGCCCCAGGAGACAGCAGGTGGG + Exonic
1083256048 11:61496085-61496107 GGGCTGACGGGACAGCAGGTGGG + Intergenic
1083771828 11:64871851-64871873 TGCCTGTGCAGACAACAGGTTGG - Intronic
1085216862 11:74840595-74840617 GCTCTGATGAGAGATCAGGTTGG - Exonic
1085266127 11:75239136-75239158 GGTCTGTGGAGGTAACAGGCTGG - Intergenic
1087129708 11:94657784-94657806 GGTCTGAGGTGAGAACAGTAGGG + Intergenic
1088918414 11:114244272-114244294 GGCCTGAGGAGCCAGCAGGATGG + Intronic
1092158839 12:6303957-6303979 GGGCTGAGGAGACAACAGAGAGG - Intergenic
1092292385 12:7169539-7169561 GGACTGAGGAGACTCCAGGGAGG - Intergenic
1093353615 12:18135080-18135102 GGTCTGAGGAGACAACAGGTTGG + Intronic
1094130016 12:27064570-27064592 GGTCTGAGCAGACAGGAGCTGGG - Intronic
1094179475 12:27576566-27576588 GGTCTGAGCAGACAGGAGCTGGG - Intronic
1094288294 12:28818014-28818036 GGTCTGTGGGGACAACTGGATGG + Intergenic
1096103225 12:48981790-48981812 GGTTTGAGGAGTCCCCAGGTAGG - Intergenic
1097186731 12:57200160-57200182 GCTGTGGGGAGACAAGAGGTAGG - Intronic
1098015726 12:66102744-66102766 GCTCTGAGTAGACAATAGGTCGG + Intergenic
1100431154 12:94533086-94533108 GGTTTGGGGAGACGGCAGGTGGG - Intergenic
1101201809 12:102444169-102444191 GGTGTGAGGAGTCAAGAGGGAGG + Intronic
1102571749 12:113830983-113831005 GGTCGGGGGAGACTACAGGGAGG + Intronic
1103976531 12:124706214-124706236 GGTCTGAGGAGCCCTGAGGTGGG - Intergenic
1106504755 13:30361309-30361331 GGACTGAGGAGAGATCAGGTGGG - Intergenic
1109385016 13:61617331-61617353 GGGTTGAGCAGAGAACAGGTGGG + Intergenic
1111920179 13:94402119-94402141 GCTCTCAGGAGAACACAGGTGGG + Intronic
1113821514 13:113217262-113217284 TGTTTGAGGAGACAAAAGGATGG + Intronic
1122742913 14:103882134-103882156 GGTATGAGGAGGCAGCAGGGAGG - Intergenic
1125728254 15:41879148-41879170 GGGATGGGGAGACAACAGGTAGG - Intronic
1128307528 15:66609687-66609709 GGTCTGAGGTCACATCATGTAGG - Intronic
1128747511 15:70124959-70124981 GGTTTGAAGAGACAACATGAAGG - Intergenic
1129083127 15:73059301-73059323 GTTCTGAGGAGTTAGCAGGTTGG + Intronic
1132826905 16:1909689-1909711 GGGCTGTGGAGACCACAGCTAGG + Intergenic
1133347199 16:5078927-5078949 GGGGTGAGGAGAACACAGGTTGG - Intronic
1135298228 16:21301522-21301544 GGGCTGGTGAGGCAACAGGTGGG + Intronic
1135562690 16:23488570-23488592 GGTCTGATCAGACACCATGTAGG + Intronic
1137755907 16:50902019-50902041 GGTGTTGGGAGACAACAGGGTGG + Intergenic
1138580411 16:57937378-57937400 AGTTGGAGGAGACAATAGGTGGG + Intronic
1140031211 16:71340699-71340721 GCTCTGAGCAGACAGGAGGTGGG - Intergenic
1143247980 17:5501732-5501754 GGCCTGAGTAGACCGCAGGTGGG - Intronic
1143493673 17:7298269-7298291 GATGTGAGGAGACCAGAGGTGGG + Intergenic
1144590609 17:16520674-16520696 GTGCTGGGAAGACAACAGGTTGG + Intergenic
1145270100 17:21400289-21400311 GGTGTGAGGAGACAGGAGGGAGG - Intronic
1145297252 17:21601434-21601456 CCTCTGAGGAGATAACAGGCAGG + Intergenic
1145308322 17:21687740-21687762 GGTGTGAGGAGACAGGAGGGAGG - Intergenic
1145366700 17:22271466-22271488 CCTCTGAGGAGATAACAGGCAGG - Intergenic
1146788000 17:35735018-35735040 GGACTGTGGGGACAAGAGGTGGG - Exonic
1147168891 17:38606756-38606778 AGTCTGCGGAGCCAACAGGTAGG - Intergenic
1148797659 17:50204794-50204816 GGTCTGAGGAGACAGAAGGGCGG + Intergenic
1148995133 17:51702847-51702869 GGTCTAAAGAGACAAAAGGAAGG - Intronic
1150421454 17:65039641-65039663 GGTCTGAGGAGGCAACATTTAGG - Intronic
1152335709 17:79699383-79699405 GGTCTGAGGTGAGAGCAGGCAGG - Intergenic
1156850083 18:41715936-41715958 GGGGTGAGGAGGTAACAGGTTGG + Intergenic
1157404773 18:47413691-47413713 GGGCTGAGGAGACCTCAGGCAGG - Intergenic
1157492325 18:48132784-48132806 TGTTTCTGGAGACAACAGGTTGG - Intronic
1157567306 18:48688300-48688322 GGGCTGAGGTGACAACATGTCGG - Intronic
1158093222 18:53739881-53739903 AGTCTGAGGAGGCAAAGGGTTGG - Intergenic
1160565441 18:79784118-79784140 GGTCTGAGGACGCCACAGTTTGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162057695 19:8074507-8074529 GGTCTCAGGAGAGAGCAAGTGGG + Intronic
1162178677 19:8851353-8851375 GGTCTGGGGAGACAAGGGCTGGG + Exonic
1162328249 19:10011241-10011263 GGACTGAGGATAAAGCAGGTAGG - Intergenic
1162480263 19:10923467-10923489 GGTCTGGGGTGGCCACAGGTGGG - Intronic
1163287518 19:16357793-16357815 GGTCTGATGAGTCTCCAGGTCGG + Intronic
1163702208 19:18791501-18791523 GGTCTGTGGAGAGAGCTGGTGGG + Intergenic
1163710933 19:18846360-18846382 GGTCTGAGGAGGCCAAAGGAAGG - Intronic
1163738603 19:18996969-18996991 GGTCTGAGCAGGGGACAGGTGGG + Intronic
1166174391 19:41055738-41055760 TGTATAGGGAGACAACAGGTGGG + Intergenic
1166918070 19:46209404-46209426 GGGCTAAGGGGACAAAAGGTGGG - Intergenic
1167069243 19:47210243-47210265 GGTCTGAAAAGGCAACTGGTAGG - Intronic
1167080065 19:47272144-47272166 GGTCTGAGGCAACTCCAGGTGGG + Intergenic
927107130 2:19837411-19837433 GGGCAGAGGGGACAACTGGTAGG - Intergenic
927499700 2:23574497-23574519 GGTTCGTGGAGACAAAAGGTAGG + Intronic
929170786 2:38931219-38931241 GGCCTGAGAAGGCAAAAGGTTGG - Exonic
931145768 2:59515862-59515884 GGTCTGAGCAGACAAAATGCTGG + Intergenic
932585573 2:73025966-73025988 GCTCTGAGGACACCACAGGCAGG + Intronic
934976814 2:98808646-98808668 GGTCTGAGGTGGCAACAGTGTGG - Intronic
935756340 2:106278805-106278827 GGTCTCAGGAGACAGCAGTGAGG - Intergenic
935975832 2:108577840-108577862 GGTAAGAGGAGAGAACAGATGGG - Intronic
936113140 2:109681672-109681694 GGTCTCAGGAGACAGCAGTGAGG + Intergenic
936587033 2:113767153-113767175 GGTCTGAGGAGAGAAATCGTTGG - Intergenic
937488198 2:122338034-122338056 TGTCTACGGAGATAACAGGTAGG + Intergenic
942200633 2:173567558-173567580 GGTCTGAGGAGAGAGCTGGCAGG - Intergenic
942821362 2:180119668-180119690 GGTCTGAGGAGAGGACATTTCGG - Intergenic
945191828 2:207196745-207196767 GCTCTCAGGAGGCAGCAGGTAGG + Intergenic
948292218 2:236834165-236834187 GGTCTGTGGAGACAAGAAGAAGG - Intergenic
948655567 2:239474981-239475003 GGTCAGAGGCCACATCAGGTAGG - Intergenic
1169432601 20:5552210-5552232 GGTCTGAGGAGGGGAAAGGTGGG - Intronic
1171324752 20:24281608-24281630 GGTCTGAGGAGACTCCAAGGAGG + Intergenic
1171879727 20:30609844-30609866 TGTCTTAGGAGACCACAGGTGGG - Intergenic
1179430043 21:41315706-41315728 GGTTTGGGGAGACTGCAGGTGGG + Intronic
1180119517 21:45737497-45737519 GGTCTGAAGAGCCTACAGTTAGG - Intronic
1182472069 22:30554844-30554866 GGTCTGAGGTGGCACCAGGAGGG + Exonic
1182619641 22:31611823-31611845 CGCCAGTGGAGACAACAGGTGGG + Exonic
1183218364 22:36495922-36495944 GGTCTGAGGAGCCCACAGGTTGG + Intronic
1183953806 22:41367582-41367604 GGCCAGAGAAGAGAACAGGTAGG + Intronic
950145481 3:10646889-10646911 AGGTTGAGGAGACAACATGTGGG + Intronic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
951404405 3:22277719-22277741 GATCTGATGAAACAACAGGGAGG + Intronic
952605162 3:35137893-35137915 GGTCTGAAGAGACTACTGGCAGG - Intergenic
955230567 3:57095642-57095664 GGTCTGAGTAGGCATCATGTGGG - Exonic
957051598 3:75416091-75416113 GGGGTGAGGAGAACACAGGTTGG - Intergenic
959621466 3:108402802-108402824 AGACTGAGCTGACAACAGGTTGG - Intronic
961302879 3:125933504-125933526 GGGGTGAGGAGAACACAGGTTGG + Intronic
961766031 3:129211826-129211848 GATCCGAGGAGGCAACTGGTGGG - Intergenic
961885190 3:130092271-130092293 GGGGTGAGGAGAATACAGGTTGG - Intronic
962969657 3:140387123-140387145 GCTCTGAGGAGAAAAAAGATGGG + Intronic
963155116 3:142087970-142087992 GGACTGAGGATACAACAGCAAGG - Intronic
963307524 3:143669701-143669723 GGTCTGATCAGAACACAGGTTGG - Intronic
963781604 3:149492205-149492227 GGTGTGAGGAGAAAAGAGGAAGG + Intronic
964389786 3:156185137-156185159 GGTCACTGAAGACAACAGGTAGG - Intronic
966355560 3:179074763-179074785 GGGCTGATGAGCCTACAGGTCGG + Intergenic
966585445 3:181618967-181618989 GGTGTGAGGAGACATCAGGTTGG - Intergenic
966653163 3:182323788-182323810 TTTCTGAGGAGACAACATTTGGG - Intergenic
966730253 3:183144919-183144941 GCTCTGGGGAAACAACAGGTGGG + Intronic
968994381 4:3936470-3936492 GGTGTGAGGACAACACAGGTTGG - Intergenic
971359446 4:25923223-25923245 GGTCTGAAGAGGCCACAGTTAGG + Intronic
974380502 4:61133996-61134018 GGTAGGAGGTGACAACAGTTTGG + Intergenic
976119330 4:81762516-81762538 GCTCTGAGGAGATTACAGGAGGG - Intronic
977758462 4:100701778-100701800 GGTGGCAGGAGTCAACAGGTGGG - Intronic
979161791 4:117470773-117470795 GATCTGAGAAGACAAGAGGATGG - Intergenic
979292586 4:118994132-118994154 GGTCTTAGGAGGCCACACGTTGG - Intronic
982719120 4:158841148-158841170 GTTCTGGGGAGACAACAGGGTGG + Intronic
984213152 4:176875716-176875738 GGACTGAGAAGACGAGAGGTGGG + Intergenic
984855309 4:184189906-184189928 CGTGTGAGGAGACAAGTGGTTGG + Intronic
986914742 5:12605276-12605298 GGTCTGAGGAGGCAAAGGTTAGG + Intergenic
989641678 5:43589136-43589158 GGACTGAAGAGACTTCAGGTTGG - Intergenic
991001052 5:61783606-61783628 GGGCTGAGGAGAGGAAAGGTGGG - Intergenic
992161990 5:74013135-74013157 GGGCAGAGGGGACAACAGGAGGG - Intergenic
992668768 5:79037555-79037577 GGGTGGAGAAGACAACAGGTGGG - Intronic
993658764 5:90604010-90604032 AGTCTGAGGAGACATTAGGAGGG + Intronic
994399386 5:99260235-99260257 GGTCTGATGAGACAATAATTGGG + Intergenic
998351901 5:141507563-141507585 GGTCTGAGGAGATGCCAAGTTGG + Intronic
999145462 5:149390299-149390321 GATCTAAGGAGGCAACAGGTGGG + Intronic
999868273 5:155725771-155725793 TGTCAGAGGAGAGACCAGGTGGG + Intergenic
1000279170 5:159767381-159767403 GGACTGAGGAGAAAACATCTGGG - Intergenic
1002068703 5:176665623-176665645 TGTCTGAGGAGGCAGCATGTGGG + Intergenic
1003392760 6:5727688-5727710 GGTCTGAGGAGTTCACAGATTGG + Intronic
1005809062 6:29502510-29502532 GCACTTAGGAGACAGCAGGTGGG - Intergenic
1006248131 6:32758014-32758036 GGTCTTTGGACACAATAGGTGGG + Intronic
1006407642 6:33854609-33854631 AATCAGATGAGACAACAGGTGGG + Intergenic
1007794157 6:44334208-44334230 GATCTGAGCAGACAGCATGTGGG + Intronic
1009050936 6:58275803-58275825 GGTCAGAGGAGGGAACATGTTGG + Intergenic
1009239488 6:61166581-61166603 GGTCAGAGGAGGGAACATGTTGG - Intergenic
1010921508 6:81687476-81687498 GATGTGAGGAGACATAAGGTAGG - Intronic
1011725168 6:90203857-90203879 GGTCTGAGGAAACACCAGAAAGG - Intronic
1016604767 6:145907685-145907707 AGCCTGAGGAGAGAATAGGTTGG - Intronic
1019164499 6:170088925-170088947 CGTCTGATGAGACACCAGCTGGG + Intergenic
1022671035 7:32456448-32456470 GGTTTCAGGAGACAACAGGTAGG - Intergenic
1029170706 7:98627485-98627507 GGTCTGAGGGGCCAACAGCTGGG - Intronic
1033360800 7:140637763-140637785 GGTCTGAGAAGGGGACAGGTAGG - Intronic
1035304538 7:157923304-157923326 TGACTGAGAAAACAACAGGTGGG + Intronic
1036794251 8:11743684-11743706 GGTCAGAGGAGAGGAGAGGTCGG + Intronic
1037438995 8:18894843-18894865 GGTCTGAGGAGACATCCGGAAGG + Intronic
1037911900 8:22748599-22748621 GGTCTGAGGGGAGAACAAGGAGG + Intronic
1039595506 8:38787296-38787318 GGCCTGAGGAGGCCACAGGACGG + Exonic
1040561236 8:48524964-48524986 GGTCTGAGGACACACCAGACAGG - Intergenic
1040599373 8:48869371-48869393 GGGCTGTGGAGACAGCTGGTGGG + Intergenic
1041779947 8:61567216-61567238 GGTCTGCAGGGACATCAGGTAGG + Exonic
1042456687 8:69013577-69013599 GGTGTTAGGTGAGAACAGGTAGG + Intergenic
1043464731 8:80493488-80493510 AGTTTGAGGAGAGAACTGGTTGG + Intronic
1043654189 8:82641176-82641198 GGTTTAAGGAGAAACCAGGTGGG + Intergenic
1044515852 8:93137516-93137538 GGTCTGGGGAGACAAAAGAAAGG + Intronic
1044572016 8:93730611-93730633 TTTCTGAGGGGACAACAGGAGGG + Exonic
1047625706 8:126653872-126653894 GGTCTGCACAGAGAACAGGTGGG + Intergenic
1047872127 8:129095758-129095780 TGTCAGAGGAGAGAACGGGTGGG + Intergenic
1047934254 8:129761357-129761379 GCTGTGAGGGGACAACAGGTGGG - Intronic
1047940152 8:129821722-129821744 GCTGTGAGGAGACAATGGGTGGG - Intergenic
1048651289 8:136481221-136481243 AGAATGAAGAGACAACAGGTAGG - Intergenic
1049535753 8:143180925-143180947 GGTGAGAGGAGAGAACAGGGTGG - Intergenic
1050162716 9:2734732-2734754 GGCCTGAGGGAACAACAGGAGGG - Intronic
1051616839 9:19014743-19014765 GAACGGAGGAGACAACAGGTAGG - Intronic
1052338240 9:27340697-27340719 AGTCTGAGCAGAAATCAGGTTGG - Intronic
1055612668 9:78038941-78038963 GGTCTAATGGGACAGCAGGTGGG - Intergenic
1055978342 9:81976108-81976130 GGAATGAGAAGACAACAGATGGG + Intergenic
1058587613 9:106527509-106527531 TGTCTGAGGTGAGCACAGGTTGG - Intergenic
1059377964 9:113900681-113900703 GGTGCTAGGAGACAGCAGGTCGG - Intronic
1062039320 9:134396836-134396858 GGTCTGAGCAGGCCACAGGCTGG - Intronic
1062491081 9:136805190-136805212 GGGCTGAGGAGGGAGCAGGTTGG + Intronic
1186772005 X:12827419-12827441 GGGCTGTAGAAACAACAGGTAGG + Intergenic
1187125718 X:16452498-16452520 GGTTTGAGGAGACTTCAGGGAGG - Intergenic
1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG + Intergenic
1194396211 X:93389539-93389561 AGTCTGAGGAGAAGACAGGTGGG + Intergenic