ID: 1093356236

View in Genome Browser
Species Human (GRCh38)
Location 12:18171840-18171862
Sequence ATGCCATTCTAGAAGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 26, 3: 65, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093356236_1093356238 2 Left 1093356236 12:18171840-18171862 CCTTCAATCTTCTAGAATGGCAT 0: 1
1: 1
2: 26
3: 65
4: 164
Right 1093356238 12:18171865-18171887 TTTGTTAGGTCCTTTTTCGATGG 0: 1
1: 40
2: 42
3: 31
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093356236 Original CRISPR ATGCCATTCTAGAAGATTGA AGG (reversed) Intronic
904942481 1:34174709-34174731 TTGCCATTCTAGAGGTTAGAAGG - Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910582155 1:88840494-88840516 TTGCCATACTAACAGATTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
913133053 1:115859989-115860011 GTGCCAGTCTAGAATAGTGAGGG - Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
916881300 1:169021924-169021946 AGGGCATTCCAGAAGATTGAAGG - Intergenic
917644369 1:177015649-177015671 ATGAAATTCCAGAAGATTCATGG - Intronic
918409248 1:184241382-184241404 ATGCCATTCTCCAAGAAGGAAGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1068698900 10:59999300-59999322 ATGCCATTCTATTATATTGCAGG - Intergenic
1069282810 10:66676844-66676866 ATGACATTGTAGAAAAATGAAGG - Intronic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1071240501 10:83699866-83699888 ATCTCATTCTAGCTGATTGAAGG + Intergenic
1072267014 10:93740559-93740581 ATTCCATTCCAGAAGATAAAGGG + Intergenic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1075186435 10:120263284-120263306 AGGCCATTCTAGAAAACTGTGGG + Intergenic
1078077407 11:8174413-8174435 GGCCCATTCTAGAAGACTGAAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078749248 11:14144209-14144231 ATACCCTTTTAGAAGATGGAAGG - Intronic
1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG + Intronic
1079611950 11:22444013-22444035 AAACCATTCTAGAATATAGAGGG - Intergenic
1081647788 11:44802051-44802073 ATGACATTCTTGAACACTGATGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082892303 11:58153056-58153078 ATAACATTCTAGAAGATAGAGGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087665553 11:101043093-101043115 ATGCAATGCTAGCAGTTTGATGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089846098 11:121459814-121459836 ATGCCAATCTGGAGGGTTGAAGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093000285 12:13988542-13988564 ATGCTACTCTAGAAGATAAAAGG - Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1094558167 12:31523368-31523390 TTGCAATTCTGGAAGATTTAGGG + Intronic
1094575463 12:31681032-31681054 ATATCATTATAGAAGATTTAGGG + Intronic
1095378123 12:41556254-41556276 ATGAAAGTCTAGAAGTTTGAAGG + Intronic
1096023604 12:48342554-48342576 AGGCCATTTTAGAATATTAAAGG - Exonic
1096430175 12:51536822-51536844 CTGCAATTTTAGAAGGTTGAGGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102920504 12:116788347-116788369 AGCCCACTCTAGAAGATTGTAGG - Intronic
1103728972 12:123013528-123013550 TTGCCATTCCAGAAGATGCAGGG - Intronic
1106542950 13:30706176-30706198 ATGCCTTTCTAGGAGATTGGTGG + Intergenic
1108061663 13:46539128-46539150 ATGACATTCTAGAAAATGCATGG - Intergenic
1108074908 13:46669958-46669980 ATTCCAGTCTAGAACAATGATGG + Intronic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG + Intergenic
1118606899 14:67511007-67511029 ATGCCAGCCAAGGAGATTGAAGG - Intronic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121520221 14:94581200-94581222 ATGCCATTCCAGGAAAATGATGG + Intronic
1126740890 15:51775069-51775091 GGGCCCTTCTGGAAGATTGAAGG + Intronic
1127653714 15:61035583-61035605 GTCTCATTCTAGAAGCTTGAAGG - Intronic
1129186376 15:73909636-73909658 ATGCCACCCTAGAAGAAAGAAGG - Intergenic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130241477 15:82197141-82197163 TTGTCATTTTAGAAAATTGAAGG + Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1141442600 16:84039307-84039329 ATGCAATTGTAAAATATTGAGGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147166575 17:38596589-38596611 ATGCCATTCTGGAAGGTTGATGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1151150153 17:72078011-72078033 ATGGCATCCCAGGAGATTGAAGG - Intergenic
1153462688 18:5353902-5353924 ATCCCATGGTAGAAGATGGAAGG + Intergenic
1153707463 18:7760752-7760774 ATAACATTCTAGAAGGTAGATGG + Intronic
1153861988 18:9220894-9220916 GGGCCATTCCATAAGATTGATGG + Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1155969976 18:32073780-32073802 GTGACGTTCTAGATGATTGAGGG + Intergenic
1156631960 18:38980730-38980752 ATGCCATTCTTCTAGCTTGATGG + Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157809703 18:50685797-50685819 GTGCCATTCAAGAAGATGGCAGG - Intronic
1160095574 18:75869352-75869374 AAACCACTCTAAAAGATTGATGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1163042299 19:14611546-14611568 ATGCCTTTCTAGAAGTTCCATGG - Intergenic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165685890 19:37819546-37819568 TTCCCATCTTAGAAGATTGAAGG - Intergenic
1166208635 19:41290748-41290770 ATCCCATTTTAGAAGGTGGATGG - Intronic
1168637223 19:58005786-58005808 ATGCCATTGTAAAAGGTTCATGG + Intronic
925270448 2:2602920-2602942 ATCACATTCTAGATGTTTGAAGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929228405 2:39534196-39534218 AGTCCATTCTAAAAGTTTGAGGG - Intergenic
929278449 2:40050927-40050949 ATGCCACTCTAGTAGAGGGAGGG + Intergenic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
931637576 2:64354724-64354746 ATGCCAGTCTGCAAGATTGGGGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934240072 2:90262934-90262956 ATGCAATTCTAGAATATTTCTGG + Intergenic
934273119 2:91553817-91553839 ATGCAATTCTAGAATATTTCTGG - Intergenic
935238812 2:101160728-101160750 ATGCCATTCTAGGAGGGGGAGGG + Intronic
936682366 2:114788841-114788863 ATGCCGTTAAAAAAGATTGAAGG - Intronic
938654702 2:133419163-133419185 ATGCCACTCTAGAATGTTCAAGG + Intronic
939408428 2:141790879-141790901 ATACAATTCTAGAAGATTTAAGG + Intronic
939642730 2:144660321-144660343 ATCCCATTCTATAAGTTTTATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944268805 2:197758974-197758996 ATGTCATACAAGAAGATGGATGG - Intronic
946097714 2:217290073-217290095 TTGCCTTTCAAGAAGATTAATGG - Intronic
1169596039 20:7200028-7200050 TTTCCATTCTAGGAGATGGAGGG + Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172935850 20:38619613-38619635 CTGCCATACTAGATGATTTAGGG - Intronic
1174726192 20:52864661-52864683 TTGCAATTCTACAAGACTGATGG - Intergenic
1177274524 21:18891631-18891653 AATCCATTCTAGGGGATTGAGGG + Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177442368 21:21142957-21142979 GTGACATTCTATAAGATAGAGGG - Intronic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177900957 21:26914504-26914526 ATTCCTTTCTAGAAGATCTAAGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949655278 3:6210708-6210730 ATGCTATTTTAGAAGAAAGATGG + Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950274657 3:11649181-11649203 ATGTCATTATAGATTATTGAAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952113165 3:30148317-30148339 ATGCAAACATAGAAGATTGAGGG + Intergenic
954905977 3:54063172-54063194 CTGCCATTCTAGAAAACTTAAGG + Intergenic
957464474 3:80569888-80569910 TTGCAATTATAGAATATTGAAGG + Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958564813 3:95796669-95796691 ATGCCAATCTCAAAGCTTGATGG + Intergenic
958888039 3:99750902-99750924 ATGCCATTAGAAATGATTGATGG - Intronic
959604470 3:108227214-108227236 CTGCCATTCTAGAGGATTGTAGG + Intergenic
961406697 3:126684772-126684794 ATGCCACTCCAGAAGATTGTTGG + Intergenic
962185810 3:133258368-133258390 ATGCCCTTCTTGTAGCTTGATGG - Intronic
962375436 3:134855183-134855205 ATTCTATTTTAGAAGATTTAAGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967516836 3:190380028-190380050 ATGCCACTCAAGAAGCTTGCAGG - Intronic
968266489 3:197367291-197367313 GTGGCATTCTGGAAGACTGAGGG - Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
972078078 4:35111661-35111683 ATCCCATTCTAGAAGAGAGTTGG + Intergenic
972670237 4:41208150-41208172 ATGCCATTGTTGAAGAAGGAAGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
975062929 4:70025727-70025749 AGGCCATTTTAGAAGACTGATGG - Intergenic
975063007 4:70026720-70026742 AGGCCATTTTAGAAGACTGATGG + Intergenic
975064850 4:70047985-70048007 AAGCCATTTTAGAAGACTGATGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978575433 4:110185303-110185325 ATGACATTCTACAAAATTTAAGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979026178 4:115579239-115579261 ATTCCATTCTTGGAGATAGAGGG - Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979566855 4:122163973-122163995 CTGCAATTCTAGAACATTGTAGG + Intronic
979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
983505464 4:168548192-168548214 AAGAAATTCTAAAAGATTGAAGG + Intronic
986159618 5:5215030-5215052 ATGCTAATCTAGATGATGGATGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990950219 5:61291287-61291309 ATTCCATTCAGGAAAATTGATGG + Intergenic
991456907 5:66813836-66813858 ATGCAAATCTAGTAGTTTGATGG + Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994247155 5:97490707-97490729 ATCCCATGCTAGAAGGTGGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
996489468 5:124076592-124076614 AAGCCATCCTAAAAAATTGAAGG - Intergenic
996500465 5:124210635-124210657 ATGCCATGCTTGGAGAGTGAGGG + Intergenic
997779973 5:136647181-136647203 ATTCCTATCTAGAAGATTGCAGG + Intergenic
1000573575 5:162946744-162946766 AGGCAATTTCAGAAGATTGAGGG + Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006331743 6:33396631-33396653 GGGCTATTCTAGAAGCTTGAGGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008645051 6:53505191-53505213 TTTCCATTCAAGATGATTGATGG - Intronic
1008881555 6:56385365-56385387 ATTCCTTTCTGGAAGCTTGAGGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014242889 6:119037534-119037556 ATCTCATTCAAGAATATTGATGG - Intronic
1014567352 6:122966073-122966095 ATCCCATACTAGAACAGTGAAGG - Intergenic
1014711649 6:124813525-124813547 ATGCCATTCTAGTACATTTTTGG - Intronic
1014803179 6:125799790-125799812 ATGCTATGCTAGAAAATAGAAGG - Intronic
1015001569 6:128222628-128222650 CTGCCAATGTAGAGGATTGAAGG - Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016100861 6:140098411-140098433 ATGACATTTTAAAAGATAGAGGG - Intergenic
1016940553 6:149479903-149479925 ATGCCATTCAATAAGATTGGGGG - Intronic
1017454733 6:154591230-154591252 ATGCCAATCTGTAAGAATGAGGG - Intergenic
1018475656 6:164138284-164138306 ATGGCATTCTAGAGGTTGGAAGG + Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027760599 7:82274150-82274172 ATGCCATTCTAGGAAAAGGAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030861048 7:114629723-114629745 ATGCCAGTCTAGAAGAGTTTAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1032895484 7:136246260-136246282 AAACCATTCTAGAGGATTCAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034907121 7:154959541-154959563 AGGCCATTCTTGAAGTGTGAGGG - Intronic
1036993243 8:13624722-13624744 ATGGCATTCTGGAAAATTTATGG - Intergenic
1038004073 8:23415463-23415485 ATGGCATTCTAGATGCTTGGTGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1044127452 8:88475198-88475220 ATGACAATCTCAAAGATTGAAGG + Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046362010 8:113172042-113172064 ATGCCATTCTATGAGAATTAGGG + Intronic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051160524 9:14202468-14202490 ATCCCATTATAGAATATTGATGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186487913 X:9947840-9947862 ATGCCATGCTAAACGATTTAAGG - Exonic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189704898 X:43749994-43750016 CTGCTATTCTAAAAGGTTGATGG - Intergenic
1192882725 X:75304249-75304271 ATTCCTTCCTAGAGGATTGATGG - Exonic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193230903 X:79044911-79044933 CTCCCATTCTAAAGGATTGAGGG + Intergenic
1193500002 X:82263694-82263716 ATACTATTCTAGAAGAATAAGGG - Intergenic
1193695699 X:84705220-84705242 ATGCCAGTCCAGAATAGTGAAGG + Intergenic
1193879648 X:86906527-86906549 ATCCCATTGTAGAAGGCTGAAGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196809386 X:119616671-119616693 CTGCCATTATAGAAGAGTTAGGG - Intronic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic