ID: 1093357453

View in Genome Browser
Species Human (GRCh38)
Location 12:18184904-18184926
Sequence CACACGTATCACACTAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093357453 Original CRISPR CACACGTATCACACTAATGT AGG (reversed) Intronic
905329581 1:37183914-37183936 TACATGTACCACACTGATGTGGG + Intergenic
909728145 1:78860777-78860799 CAAATGTGCCACACTAATGTTGG - Intergenic
911028662 1:93462387-93462409 CAAATGTACCATACTAATGTAGG - Intronic
911426591 1:97722441-97722463 CAAATGTACCATACTAATGTAGG + Intronic
919903660 1:202062384-202062406 CACATGTACTATACTAATGTGGG + Intergenic
1065713264 10:28537649-28537671 CAGGAGTATCACACAAATGTTGG - Intronic
1067160061 10:43818305-43818327 CACACCCATCACACTGGTGTTGG - Intergenic
1072749406 10:97966530-97966552 CCCATGTAACATACTAATGTAGG - Intronic
1075849013 10:125571690-125571712 CATACGTAACACACAAAAGTAGG + Intergenic
1077528355 11:3082658-3082680 AACATGTAGCAAACTAATGTAGG - Intergenic
1080955736 11:37093363-37093385 CTCAGCCATCACACTAATGTGGG + Intergenic
1093357453 12:18184904-18184926 CACACGTATCACACTAATGTAGG - Intronic
1109954822 13:69551980-69552002 CAACCTTATCAGACTAATGTAGG + Intergenic
1110956918 13:81564428-81564450 CACACGTACCACTCTCATGGGGG - Intergenic
1117710390 14:58522430-58522452 CTCACACAGCACACTAATGTGGG - Intronic
1122708889 14:103640859-103640881 CAAATGTATCACAGTAATGTAGG - Intronic
1124071734 15:26401302-26401324 CCCAGGTATGACACAAATGTAGG - Intergenic
1126195162 15:45923142-45923164 AACAGGTATCACAGTAATGGTGG - Intergenic
1126340885 15:47640031-47640053 CAAATGTATCATAGTAATGTAGG + Intronic
1129912232 15:79237647-79237669 CCCACACAGCACACTAATGTGGG - Intergenic
1138524991 16:57600082-57600104 CACACCTATAACACTTATGTAGG + Intergenic
1138532904 16:57644827-57644849 CACACTGATCACACTCATGCAGG + Intronic
1146718830 17:35108540-35108562 CACAAGTAGCAAACTGATGTTGG + Intronic
1148761397 17:50003545-50003567 CAAATGTATCACACTAATGTAGG + Intergenic
1148970827 17:51479725-51479747 CATACGAATTACACTAATCTGGG - Intergenic
1152391349 17:80005789-80005811 TACAGGTAGCACACGAATGTGGG + Intronic
1153599079 18:6761434-6761456 CACACGTATCTCACAGATCTTGG + Intronic
1155418640 18:25629285-25629307 CACACATACCACACTCCTGTTGG + Intergenic
1165918489 19:39276616-39276638 CACAGTTATCCCACAAATGTAGG + Intergenic
1167909669 19:52691204-52691226 CACACGGAACAGAATAATGTTGG - Intergenic
927377809 2:22438559-22438581 CACACATATTTCATTAATGTTGG + Intergenic
932285412 2:70527673-70527695 CAAACATATCACACCAATGCAGG + Intronic
934063024 2:88313874-88313896 CAAATGTACCATACTAATGTAGG + Intergenic
937850738 2:126632890-126632912 CAAATGTATCACATGAATGTTGG + Intergenic
941270766 2:163424972-163424994 CAAATGTACCATACTAATGTAGG + Intergenic
943601360 2:189924663-189924685 CCCACACAGCACACTAATGTGGG - Intronic
943765728 2:191659654-191659676 CAAATGTTTCATACTAATGTAGG + Intergenic
945492427 2:210472093-210472115 AACAAGTATCAAAATAATGTGGG + Intronic
1169690707 20:8327984-8328006 CACACAAATCACACAAATGCAGG + Intronic
1171384518 20:24761137-24761159 CAAATGTATCACTCTAGTGTGGG + Intergenic
1178036865 21:28594382-28594404 CAAATGTACCAAACTAATGTAGG + Intergenic
1182673877 22:32021945-32021967 CAAAGGTACCACGCTAATGTTGG + Intergenic
949370704 3:3331989-3332011 CACACGTGTAGCCCTAATGTAGG + Intergenic
955930513 3:64051822-64051844 CATATGTACCATACTAATGTAGG + Intergenic
957910904 3:86619314-86619336 CACACAGATCACACGAATCTAGG + Intergenic
973918337 4:55659254-55659276 TACACGTATACTACTAATGTGGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977940859 4:102857091-102857113 CAAATGTACCACACTAATGCAGG + Intronic
978859855 4:113435269-113435291 CACATGTAGCAAACCAATGTGGG - Intergenic
979971056 4:127135968-127135990 CACACATTACACATTAATGTTGG - Intergenic
981225195 4:142285674-142285696 CTCACGTATCAGAGTAAAGTTGG + Intronic
981995535 4:150970197-150970219 CACACTTAACAGACTAAAGTAGG + Intronic
982729249 4:158938114-158938136 CATGGGTATCATACTAATGTGGG - Intronic
984027723 4:174564554-174564576 CAAATGTATCACTCTAGTGTAGG - Intergenic
989771131 5:45146962-45146984 CACACCTAGCACACAAATCTTGG + Intergenic
991724532 5:69523054-69523076 CAAATGCACCACACTAATGTAGG - Intronic
993091882 5:83436692-83436714 TACATGAATCACACTATTGTAGG - Intergenic
994961931 5:106616171-106616193 CAAATGTACCATACTAATGTCGG + Intergenic
995305976 5:110650855-110650877 CAAATGTATCATACTAATGTAGG + Intronic
1001687117 5:173602011-173602033 CACACGGCACACACTCATGTTGG + Intergenic
1008222018 6:48865793-48865815 CAAATGTATCTCACTAATGCAGG + Intergenic
1008620699 6:53269006-53269028 TACATGAATCACACTATTGTAGG + Exonic
1008824564 6:55677645-55677667 AACAGGTATCACCCTAATGTAGG - Intergenic
1011080762 6:83488224-83488246 CAAATGTATCACACTGATGCAGG - Intergenic
1024845813 7:53641293-53641315 CACATCTATCTCACTAATTTGGG + Intergenic
1025870651 7:65429666-65429688 CACACGTGTCACTCACATGTCGG + Intergenic
1041544142 8:59022295-59022317 CACAATTATCTCACTAATGGAGG + Intronic
1044028608 8:87206134-87206156 CACAGGTAATAGACTAATGTGGG + Exonic
1046291044 8:112162134-112162156 TACACATATCACATAAATGTAGG + Intergenic
1050707657 9:8421599-8421621 CACCTGTATCACCCTAATCTTGG + Intronic
1187921827 X:24210938-24210960 CACACATGTCACACTTATGGGGG - Exonic
1188377095 X:29444534-29444556 AAAACCTATCACACTAATATAGG + Intronic