ID: 1093358773

View in Genome Browser
Species Human (GRCh38)
Location 12:18199450-18199472
Sequence TAGTCCTTTTACAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 3, 1: 92, 2: 102, 3: 91, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093358773 Original CRISPR TAGTCCTTTTACAAGAGTGA GGG (reversed) Intronic
900601684 1:3505469-3505491 CAGTCCTGTGACAAGAGGGATGG - Exonic
900722231 1:4184611-4184633 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
900841068 1:5048976-5048998 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
902051193 1:13564834-13564856 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
902970088 1:20042118-20042140 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
903395702 1:23000378-23000400 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
904394231 1:30207362-30207384 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
905060204 1:35133690-35133712 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
905429565 1:37911621-37911643 TAGTCCTTTTGCAAGAATGAGGG - Intronic
906379026 1:45319825-45319847 CAGTCCTTTTGCAAGAATGAGGG - Intergenic
907430542 1:54408749-54408771 TAGTCCTTTTTCCAGGGTGGTGG - Intronic
907996535 1:59638388-59638410 TAGTCCTTGCACATGGGTGAAGG + Intronic
908170639 1:61501335-61501357 CAGTCCTTTTCCAACAATGAGGG + Intergenic
909015020 1:70371525-70371547 TAGTCTCTTTGCAAGAGTGAGGG - Intronic
909729772 1:78876794-78876816 TAGTCCCTTTGCAAGGGTGAGGG - Intergenic
910002497 1:82356743-82356765 TAGTCTCTTTGCAAGAGTGAGGG + Intergenic
910049669 1:82959462-82959484 TAGCCCTTTTGCAAGAGTGAGGG - Intergenic
910052456 1:82991578-82991600 TAGTCCTTGTAAAAGGGAGATGG - Intergenic
910479577 1:87643654-87643676 TAGTCTTTTTACAACTGTAATGG + Intergenic
910694667 1:89999320-89999342 TAGTGCTTTTACAAGGGAGAGGG + Intronic
911071458 1:93835107-93835129 TAGTCCCTTTGCAAGCATGAGGG - Intronic
911147687 1:94568451-94568473 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
911819384 1:102397968-102397990 GAGTCCTTTCAAAAGAGTGATGG + Intergenic
911984147 1:104600282-104600304 TAGTCCCTTTGCAAAAATGAGGG - Intergenic
912815033 1:112822196-112822218 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
912939173 1:114029979-114030001 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
913095440 1:115511767-115511789 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
913245470 1:116866607-116866629 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic
916329079 1:163594686-163594708 TAGTCCTTTTGCAGGACTGACGG - Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917749950 1:178044092-178044114 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
918418033 1:184332808-184332830 TAGTGCTTTTAGAAGACTGTAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918650029 1:186951169-186951191 TAATCCTTTCTCAAGAGGGAGGG - Intronic
918905424 1:190485886-190485908 TATTCATTTTACATGAGGGATGG + Intergenic
919476677 1:198038856-198038878 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
920908334 1:210191613-210191635 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
922363254 1:224842032-224842054 TAGTCCTTTTGTAAGAGCGAGGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922845128 1:228678682-228678704 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
922935100 1:229416500-229416522 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
923127589 1:231046074-231046096 TTGTCCTGCTACAAGAGTGGTGG - Intergenic
923213908 1:231831787-231831809 TCGTCCTTTTGCAAGAGTGAGGG + Intronic
924448137 1:244153103-244153125 AATTCCTTTGACAAGACTGAAGG - Intergenic
924895899 1:248337817-248337839 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1062957623 10:1550775-1550797 TAGTCATTTGGCAAGAGTGAAGG + Intronic
1064427035 10:15238612-15238634 TAGTCCTTTTACCTAAGTGACGG - Intronic
1065437938 10:25720790-25720812 TATTCTTTTTGCAAGAGTGAGGG - Intergenic
1066103115 10:32135405-32135427 TAGTCCCTTTGCAAGAGTGATGG + Intergenic
1066436865 10:35403716-35403738 TGGTCTCTTTGCAAGAGTGAGGG + Intronic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1067679641 10:48422922-48422944 AAGTCCTTTAACATGAGTAAAGG + Intronic
1068052805 10:51973350-51973372 TGCTACTTTTACAAGAGTAAAGG - Intronic
1070893747 10:79964138-79964160 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
1071063991 10:81609317-81609339 AAGTAATTTTGCAAGAGTGAGGG + Intergenic
1071187550 10:83061430-83061452 TAGTCCTTTGGCAAGAGTGAGGG - Intergenic
1071822027 10:89288793-89288815 TGGTACTTTTGCAAGAGTGAGGG - Intronic
1072011049 10:91303327-91303349 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1072884768 10:99263333-99263355 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1073014347 10:100386027-100386049 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1073130628 10:101186810-101186832 TAGTCCTTTTGCAAGAGTGAAGG + Intergenic
1073395016 10:103210395-103210417 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1073634050 10:105179027-105179049 TAGTCTTTTTCCAATGGTGATGG + Intronic
1073683792 10:105731345-105731367 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1075014222 10:118898344-118898366 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
1076267751 10:129122238-129122260 TATTCCCTCTACCAGAGTGAGGG + Intergenic
1076628873 10:131840710-131840732 TTTTCCTGTTACAGGAGTGATGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078789336 11:14526959-14526981 TAGTCCCTTTGCAAAGGTGAGGG - Intronic
1078926581 11:15880720-15880742 TAGCCCTTTCTTAAGAGTGAGGG - Intergenic
1079230835 11:18647379-18647401 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1079835713 11:25329805-25329827 TAGTCCCTTTGCAAGATTGAGGG + Intergenic
1079847363 11:25488598-25488620 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1080266365 11:30406076-30406098 TCCTCCTTCTACAAGAGAGATGG - Intronic
1080994224 11:37580620-37580642 TAGTCCCTTTGCATGTGTGAAGG + Intergenic
1081160049 11:39738902-39738924 TAGTCCCTTTGCAAGGGTGAGGG - Intergenic
1081686330 11:45045807-45045829 TTTTCCTTTTACATGAATGAGGG + Intergenic
1082020846 11:47531841-47531863 TAGTTCTTTAACAAGTGGGAGGG - Intronic
1082197467 11:49323024-49323046 TAGTCGCTTTGCAAGAGTGAGGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084354533 11:68628642-68628664 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1085988316 11:81810542-81810564 TAATCTTTTTGCAAGAGTGAGGG - Intergenic
1086133372 11:83422771-83422793 CAGTCCTTTTGGAAGAGTGAGGG - Intergenic
1086134518 11:83433001-83433023 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1086135964 11:83444290-83444312 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1086550523 11:88047515-88047537 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1086658353 11:89385103-89385125 TAGTCACTTTGCAAGAGTGAGGG - Intronic
1087161348 11:94950867-94950889 TAGTCCATTTAAAAGTGTGTGGG - Intergenic
1087167752 11:95021872-95021894 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
1087197198 11:95313637-95313659 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087658323 11:100954396-100954418 CAGTCCTTATACAAAATTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1089866760 11:121639509-121639531 TAGCCTTTTTGCAAGAGTGAGGG + Intergenic
1089953653 11:122551454-122551476 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091136892 11:133199529-133199551 CAGTCCTTTTGCAAGATAGAGGG - Intronic
1092170186 12:6369493-6369515 TAGACCTTTTGGGAGAGTGAAGG - Intronic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1094400990 12:30060314-30060336 TAGTTCTTTTGCAAGAGTGAGGG - Intergenic
1094826069 12:34270060-34270082 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1095637918 12:44453911-44453933 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1095806445 12:46325318-46325340 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1096629485 12:52916696-52916718 TCGTGCTGTTACCAGAGTGAAGG - Intronic
1096906978 12:54944989-54945011 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097541877 12:60953357-60953379 CAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1098574529 12:72026141-72026163 TACTCCTTTTTCATGAGTAAAGG + Intronic
1098920230 12:76295951-76295973 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1100940626 12:99719616-99719638 TAGTGCTTTTGCAAGAGTGAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102116461 12:110406881-110406903 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1102604828 12:114060336-114060358 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
1104257932 12:127156071-127156093 CAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1105032611 12:132894517-132894539 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
1105771228 13:23613919-23613941 TTTTCCTATTACAAGAGTAATGG + Intronic
1108702991 13:52959523-52959545 ATGTCCCTTTGCAAGAGTGAGGG + Intergenic
1108803587 13:54129270-54129292 TAGTCGTTTTGCAAGAGTGAGGG + Intergenic
1109353223 13:61209132-61209154 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1110845629 13:80187806-80187828 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1110978761 13:81870306-81870328 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1111471343 13:88686505-88686527 GAGTTCTGTTACAAGTGTGATGG - Intergenic
1112188467 13:97151010-97151032 TAGTCCTTTTAGTAGTTTGAGGG - Intergenic
1112889054 13:104209690-104209712 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
1114222011 14:20705063-20705085 TAGTTCCTTTGCAAGAATGAGGG - Intergenic
1114987098 14:28243890-28243912 TAGTCCTCTTACAACAGTCAAGG + Intergenic
1115082314 14:29470256-29470278 TTGTCCTTTTACAGCAGTTAGGG - Intergenic
1115919029 14:38351898-38351920 TAATCCTTTCACTAGAGTGAAGG + Intergenic
1116456263 14:45123918-45123940 TGGGCCTTTTAAAAGAATGAGGG - Intronic
1116490304 14:45496965-45496987 TAGTGTTTTTGCAAGAGTGAGGG + Intergenic
1116576586 14:46583054-46583076 GATCCCTTTTAGAAGAGTGAAGG + Intergenic
1117002406 14:51384096-51384118 TAGAGCTATTATAAGAGTGATGG - Intergenic
1117174469 14:53132568-53132590 CAGTTCTTTTGCAAGAGTGAGGG - Intronic
1117524751 14:56587844-56587866 TAGTCCTATTACCATAGAGATGG - Intronic
1119559993 14:75582342-75582364 TAGTCCCTTCGCAAGAGTGAGGG + Intronic
1120539283 14:85734556-85734578 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1121192970 14:92046149-92046171 TAGTCCTTTTGCAAGAGCGAGGG + Exonic
1121389692 14:93563499-93563521 TAGTCCCTTTGCAATAGTGAGGG + Intronic
1121980318 14:98448858-98448880 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1122507957 14:102243956-102243978 TAGTTCCTTTGCAAGAGTGAGGG - Intronic
1123540670 15:21286541-21286563 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1123882260 15:24687465-24687487 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1125849367 15:42888602-42888624 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1126844084 15:52743079-52743101 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129441512 15:75584306-75584328 TTGTCCTGTTAAAACAGTGATGG - Intergenic
1130304827 15:82706290-82706312 TAGTCCTTTTGCAAGACTGAGGG - Intronic
1202948981 15_KI270727v1_random:13684-13706 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1133939038 16:10293135-10293157 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1134763353 16:16733872-16733894 CAGTCCTTCTACGGGAGTGAGGG - Intergenic
1134982699 16:18625285-18625307 CAGTCCTTCTACGGGAGTGAGGG + Intergenic
1135025125 16:18993801-18993823 TAGTCCCTTTGCAAGAGAGAGGG + Intronic
1135063454 16:19290115-19290137 TATTCCTTTAAAAAGAGTGGGGG + Intronic
1135228182 16:20679895-20679917 TAGGCCCTTTACAGGAGGGAGGG - Intronic
1136530251 16:30863327-30863349 TAGTCCCCTTGCAAGAGTGAGGG - Intronic
1137055024 16:35741231-35741253 AAGTCCTTTTGCAAGAGTGGGGG + Intergenic
1137363753 16:47842896-47842918 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1137896361 16:52217000-52217022 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1138758810 16:59519223-59519245 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1138864011 16:60794531-60794553 GAGACCTTTTACAAGATTGAGGG - Intergenic
1139232750 16:65301654-65301676 TATTCCTTTTACATGAGTTTTGG - Intergenic
1139541912 16:67624317-67624339 CAGTCATTATACCAGAGTGATGG - Intronic
1143414027 17:6733008-6733030 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145080392 17:19890202-19890224 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1149159768 17:53677937-53677959 TAGTCCTTTTCCTAAAGGGAAGG + Intergenic
1151134802 17:71936041-71936063 TAGTCTTTTTTCAAAATTGAAGG + Intergenic
1151503056 17:74504694-74504716 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1152454277 17:80404083-80404105 TACTCCTTCTGCAAGAGTGAGGG - Intergenic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155941831 18:31807927-31807949 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1155962277 18:32004576-32004598 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1156302571 18:35848253-35848275 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1156916113 18:42465742-42465764 TAGTCCCTTTTCAAGAGTGACGG - Intergenic
1156923830 18:42554494-42554516 TAATCCTTTTGCAAGAGTGAGGG + Intergenic
1158576517 18:58643297-58643319 TAGTCCCTTTGTAAGAGTGAGGG + Intergenic
1159463031 18:68744374-68744396 TACTCCTTTTATAAGAGTTGGGG + Intronic
1159929447 18:74296105-74296127 CAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1160397064 18:78580296-78580318 TAGTCCTAAAACAACAGTGAGGG + Intergenic
1162262573 19:9544740-9544762 TATTCCCTTTGCAAGAGTGAAGG - Intergenic
1163343107 19:16722591-16722613 TAATTCTTTTTTAAGAGTGAGGG - Intronic
1163899871 19:20091828-20091850 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1163944175 19:20520705-20520727 TAGTCCCTTTGCAAGATTGAGGG + Intergenic
1164003694 19:21130611-21130633 CAGTACCTTTGCAAGAGTGAGGG + Intergenic
1164081133 19:21862292-21862314 TAGTCCCTTTGTAAGAATGAGGG - Intergenic
1164153259 19:22572366-22572388 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1164220341 19:23187594-23187616 CAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1164259079 19:23553546-23553568 TAGTCCCTTTGCAAGAATGAGGG - Intronic
1165249470 19:34517652-34517674 AAGTCTCTTTGCAAGAGTGAGGG - Intergenic
1166905443 19:46105271-46105293 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1167058221 19:47126716-47126738 TGATCATTTTACAAGAGTTATGG + Intronic
1167901454 19:52625226-52625248 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1168211843 19:54896479-54896501 TAGTCCTTTTGCATCAGTGAGGG + Intergenic
1168248538 19:55127145-55127167 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
925433554 2:3817403-3817425 CAGTCCCTTTGCAAGAGTGAGGG + Intronic
927134431 2:20086345-20086367 TGGTCCTTTTGCAAGAGTGAGGG - Intergenic
927612844 2:24559166-24559188 TCGTCCTTTTAGCAGAGAGATGG - Intronic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929266376 2:39923236-39923258 TGGTCATTTTTCAACAGTGATGG + Intergenic
929383886 2:41382438-41382460 TAGTCCATTTGCAAGAGTGAGGG - Intergenic
930098716 2:47586855-47586877 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
930331047 2:49984322-49984344 TAGTGATTTTACTAGAATGAAGG - Intronic
930706410 2:54508998-54509020 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
933179502 2:79213428-79213450 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
935272107 2:101443771-101443793 TAGTCCTTTGGCCAGAGTGCAGG - Intronic
936794013 2:116185847-116185869 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
936870953 2:117133612-117133634 TAGTCCCTTTGCAGGAGTGAGGG - Intergenic
937594690 2:123659542-123659564 CAGTCCTTTTGCAGGAGTGAAGG + Intergenic
938372869 2:130784194-130784216 TATTCCTTTTACAAGAGATCTGG - Intergenic
939094853 2:137822691-137822713 TAGTCCTTTCGCAAGAGCGAGGG - Intergenic
939307690 2:140430264-140430286 TAGTCCTTTTGCGAGAGTGAGGG - Intronic
939460461 2:142491430-142491452 TAGTCCCATTGCAAGAGTGAGGG + Intergenic
940508545 2:154585118-154585140 TAGTCCTTTTGTAAGAGTGAGGG + Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
941455856 2:165711706-165711728 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
941608688 2:167633318-167633340 TAGCCCATTTACAAGTCTGATGG - Intergenic
941750900 2:169134671-169134693 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
943412646 2:187562069-187562091 TAGTCCTTTTGCAATAGTGAAGG + Intronic
943460909 2:188170788-188170810 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
944251371 2:197582609-197582631 TTGTCCCTTTGCAAGAGTGAGGG - Intronic
944387732 2:199183499-199183521 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
944996519 2:205300968-205300990 TGGTCCTTGTAGAAAAGTGAAGG - Intronic
945361918 2:208903355-208903377 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945376387 2:209082198-209082220 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945554984 2:211265567-211265589 TAGTCCCTTTACAAGAGTGAGGG - Intergenic
945679931 2:212901917-212901939 TAGTTATTTTACAGGAGTCAAGG - Intergenic
945858461 2:215094089-215094111 CAGTCCTTCTGAAAGAGTGAGGG - Intronic
946871444 2:224089228-224089250 TAGTACCTTTGCAAGAGTGAGGG + Intergenic
947598806 2:231431843-231431865 CAGTCCCTTTGCAAGACTGAGGG + Intergenic
947842509 2:233217217-233217239 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
1168942995 20:1729343-1729365 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
1170236406 20:14110178-14110200 TAGATCTTTTACAAACGTGAAGG - Intronic
1170680125 20:18518973-18518995 TAATTCCTTTGCAAGAGTGAGGG + Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173480791 20:43397676-43397698 TATTCCTTTTGCAAGGCTGATGG + Intergenic
1173652383 20:44674864-44674886 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177953875 21:27572394-27572416 TGGTCCTTTTAATTGAGTGAAGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1182256860 22:29045405-29045427 TAGCCCTTTTAGAACAGAGAAGG - Intronic
1183635318 22:39058666-39058688 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
1183722440 22:39570582-39570604 TAATCCTCATGCAAGAGTGAGGG + Intergenic
1184472948 22:44706105-44706127 TAGTGTTTTTACAAGAGAAAGGG - Intronic
949182437 3:1150473-1150495 TAGTGCTTTTACTATAGTCATGG + Intronic
951060848 3:18205358-18205380 TAGTGCTTAAAGAAGAGTGAGGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
951894896 3:27601259-27601281 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
952297214 3:32072079-32072101 TAATTCCTTTGCAAGAGTGAGGG - Intronic
952343299 3:32463044-32463066 TAGTCCTTTTGCAGGAGTGAGGG + Intronic
952894881 3:38071873-38071895 TAGTCCTTTTCCAAGAGTGAGGG + Intronic
953051782 3:39350840-39350862 TAGGCCTTTTATAGGAGGGAGGG - Intergenic
953656221 3:44856890-44856912 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
953834152 3:46328700-46328722 CAATCCTTTTGCAAGAGTGAGGG + Intergenic
954161445 3:48725692-48725714 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
956003065 3:64749598-64749620 TGGAACTTTTACAAAAGTGAGGG + Intergenic
956233237 3:67040367-67040389 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
956371406 3:68566402-68566424 TAGCCATTTTTCAGGAGTGAGGG + Intergenic
956622386 3:71234416-71234438 CAGTTCTTTTGCAAGGGTGAAGG - Intronic
956771050 3:72526257-72526279 TAGACCCTTTACATGAGGGAGGG + Intergenic
957451727 3:80388990-80389012 TAGTCCCGTTGCAAGAGTGAGGG - Intergenic
957675039 3:83355199-83355221 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
957734609 3:84189540-84189562 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
957904520 3:86539589-86539611 TAGTTCATTTGCAAGAGTGAGGG + Intergenic
958422280 3:93942252-93942274 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
958676514 3:97274561-97274583 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
958948350 3:100390280-100390302 TAGTTCTTTTGCGAGATTGACGG - Intronic
960559115 3:119062941-119062963 TAGTCCTTTTCTCATAGTGAGGG - Intronic
962021933 3:131510981-131511003 TAATCCCTTTGCAAGAGTGAGGG + Intergenic
962523645 3:136219318-136219340 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
963111587 3:141693204-141693226 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
963193297 3:142497851-142497873 TAGTTTTTTTCTAAGAGTGATGG + Intronic
963320082 3:143801790-143801812 TAATCCCTTTGCAAGAGTGAGGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964125175 3:153228266-153228288 TAGTCCTTTTGCAGGAGTGAGGG + Intergenic
964299943 3:155276553-155276575 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
964857303 3:161160314-161160336 TACTTCTTTGACAAGAGTCAGGG - Intronic
964940643 3:162155512-162155534 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
965070630 3:163911867-163911889 TAGTCCTTTGGCAAGATTGAGGG - Intergenic
965335439 3:167427097-167427119 TAGTCCCTTTGCAAGAGTAAGGG - Intergenic
965861674 3:173157338-173157360 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
966067144 3:175832014-175832036 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
966279618 3:178211864-178211886 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
966290455 3:178350418-178350440 TAGCCCTTGAAAAAGAGTGAAGG + Intergenic
966398146 3:179522521-179522543 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
970256136 4:14172107-14172129 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
970533012 4:17001792-17001814 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
970853773 4:20631880-20631902 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
970909099 4:21253557-21253579 AATTCCTTTTCCAAGACTGATGG - Intronic
971055178 4:22904910-22904932 TTGTCCTTTTATCAGATTGAGGG - Intergenic
971329879 4:25673611-25673633 CATTTCCTTTACAAGAGTGAAGG - Intronic
973008582 4:45044059-45044081 CAGACCTTGTACAGGAGTGAGGG - Intergenic
973149097 4:46865463-46865485 TGGTCCTTTTACAAAGGTAATGG - Intronic
973751395 4:54023767-54023789 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
974173137 4:58292909-58292931 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
974904114 4:68035111-68035133 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
976719279 4:88154415-88154437 TAGTCCCTTTGCAAGAGCAAGGG + Intronic
976739617 4:88344968-88344990 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
977225061 4:94385054-94385076 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
977449125 4:97171996-97172018 TAATCCTTGTTCAAGAGTGCTGG - Intergenic
977546768 4:98392375-98392397 TAATCTTTTTACATGAGGGATGG + Intronic
977782173 4:100993456-100993478 AAGTCCTTTTGCAAGAGTGAAGG + Intergenic
979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG + Intergenic
980003087 4:127513057-127513079 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
980302381 4:131011341-131011363 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
980928251 4:139159932-139159954 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981482622 4:145254401-145254423 TAGTCTCTTTGCAAGAGTGAGGG + Intergenic
982319143 4:154060775-154060797 CAGTCATTTTGCAAGAGTGAGGG - Intergenic
982396448 4:154920438-154920460 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
983056343 4:163102456-163102478 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
983859178 4:172683506-172683528 AAGTCCTTTTTCAAGGGTTAGGG - Intronic
983883445 4:172957746-172957768 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
984197884 4:176681025-176681047 TACTCCTTTTAAAAGACTCAAGG - Intergenic
984322464 4:178211211-178211233 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
984437576 4:179724776-179724798 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
985078717 4:186243738-186243760 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
986368637 5:7059521-7059543 TAGTCCTTTTGTAAGAGTGAGGG + Intergenic
987248693 5:16077199-16077221 TAGTCCATATACTAGAGTGTGGG - Intronic
987841845 5:23232450-23232472 GATGCCTTTTAGAAGAGTGAAGG + Intergenic
988199409 5:28049980-28050002 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989614850 5:43329374-43329396 TAGTCCCTTTGCAGGAGTGAAGG + Intergenic
989660169 5:43789906-43789928 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
989688587 5:44115940-44115962 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990564856 5:57018734-57018756 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
990799961 5:59589501-59589523 CAGTCCTTATACAAGAGAGTAGG + Intronic
990886414 5:60599616-60599638 TTGTCCGTTTACAGGAATGAGGG + Intronic
992053077 5:72958985-72959007 TATTCTTGTTACAAGAGGGATGG + Intronic
992393917 5:76354622-76354644 TAGTCCTTTTAAAACACTAATGG + Intergenic
992451724 5:76882056-76882078 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
994125820 5:96168471-96168493 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
994295423 5:98083194-98083216 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
994375490 5:99012944-99012966 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
994778673 5:104065783-104065805 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
994964176 5:106645207-106645229 TAGTCCTTTTATAATAGTGCAGG + Intergenic
996574750 5:124968496-124968518 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
996723152 5:126649210-126649232 CAGTCCTTTTGCAAGGGTGAGGG - Intergenic
996725497 5:126670360-126670382 TAGTCCCTTTGCAAGAATGAGGG + Intergenic
996917946 5:128733458-128733480 TAGTCTCTTTGCAAGAGTGAAGG - Intronic
997678520 5:135733108-135733130 TAGTCCTTTTGCAAGGGCGAGGG + Intergenic
1000438839 5:161244095-161244117 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1000440023 5:161252827-161252849 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1000607212 5:163337974-163337996 CAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1001353964 5:171002601-171002623 TAGTCCCTTTGCAAGAGTGAAGG + Intronic
1001524574 5:172419475-172419497 TAGTGCTTTGACAACAGGGAAGG + Intronic
1003100089 6:3170362-3170384 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1003541506 6:7022389-7022411 TATTCCTATTAAATGAGTGAAGG - Intergenic
1003925734 6:10876208-10876230 TAGTTCTTTTAATAGAGTGAAGG - Intronic
1004246331 6:13980171-13980193 AAGGCCTTTTAAAAGTGTGATGG - Exonic
1004541245 6:16552365-16552387 TACTCCTTTAACAGGAGTAAAGG + Intronic
1006325112 6:33347776-33347798 TAGTCCCTTTGCAAAAGTGAGGG - Intergenic
1007084418 6:39133333-39133355 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1007300646 6:40865481-40865503 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1009270084 6:61604074-61604096 TAGTCCTTTTGCAAGAGCAAGGG - Intergenic
1009379405 6:63009297-63009319 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1009464662 6:63954380-63954402 TCGTCCCTTTGCAAGAGTGAGGG - Intronic
1009749975 6:67870248-67870270 TAGTACCTTTGCAAGAGTGAGGG + Intergenic
1010586413 6:77662137-77662159 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1010829423 6:80511900-80511922 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1010841067 6:80649650-80649672 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012675374 6:102106075-102106097 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1013807766 6:114013701-114013723 TAATCCCTTTGCAAGAGGGAGGG + Intergenic
1014115011 6:117660925-117660947 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1014612305 6:123560298-123560320 TAGCCCCTTTGTAAGAGTGAGGG - Intronic
1015801073 6:137062705-137062727 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1016594332 6:145782420-145782442 AAGTAATTTTAAAAGAGTGAAGG + Intergenic
1016751221 6:147632378-147632400 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1016798240 6:148141185-148141207 TAGTTCTTTTAGAAAAGTTAGGG - Intergenic
1017270129 6:152494601-152494623 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1017922539 6:158884777-158884799 TAATTCCTTTGCAAGAGTGAGGG + Intronic
1017926341 6:158914475-158914497 CCGTCCTTTAACAAGGGTGAGGG + Intergenic
1018077878 6:160232441-160232463 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1018136042 6:160779251-160779273 TAGTCCCTTTGCAAGAGCGAGGG - Intergenic
1020540821 7:9459922-9459944 TAGTTGTTTTGTAAGAGTGAGGG + Intergenic
1020794507 7:12663786-12663808 TAGTCCTTTTGCAAGAGAGAGGG - Intergenic
1021172995 7:17418212-17418234 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1021368434 7:19810804-19810826 TAGTTCTTTTAAAAGGTTGAAGG + Intergenic
1021430129 7:20549565-20549587 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1021660871 7:22916849-22916871 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1022447698 7:30483346-30483368 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1024497596 7:50066207-50066229 TAGGCCTTTTATAGGAGAGAGGG + Intronic
1024738940 7:52335077-52335099 CAGTCCTTTTGCAAGAGTAAGGG + Intergenic
1025615026 7:63111023-63111045 TAGTCTTTTTAGTAGAGTCAGGG - Intergenic
1027158657 7:75786427-75786449 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1027354637 7:77343350-77343372 TAGTCCTTTTGCAAGATTGAGGG - Intronic
1028042604 7:86073912-86073934 GAATCCTTCTATAAGAGTGAGGG - Intergenic
1028589559 7:92480991-92481013 TAGTCCCTTTGCAAGAGTGAAGG + Intergenic
1029099009 7:98112718-98112740 TAGGCCCATTACAAGGGTGAGGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029818273 7:103119743-103119765 GAGTCCTTTTACACCAGTGCTGG + Exonic
1030163295 7:106529803-106529825 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1030445577 7:109644217-109644239 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1031354918 7:120778725-120778747 TAGTGCTTTTGCAAGAGTGAGGG + Intergenic
1031777651 7:125921909-125921931 TTGTCCTTTCGCAAGAGTGAGGG - Intergenic
1033084982 7:138332992-138333014 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1033211778 7:139465221-139465243 TAGTCCTTTTGCAAGAGCAAGGG - Intronic
1033464726 7:141580199-141580221 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1033625841 7:143108784-143108806 TAGTCCCTTTGCAAGAGTGAAGG - Intergenic
1035841694 8:2818821-2818843 GAGTCATATTACTAGAGTGATGG + Intergenic
1036472055 8:9061025-9061047 TAGTCCTTTTGCAAGAGCGAGGG + Intronic
1036549990 8:9807209-9807231 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1037045231 8:14292246-14292268 TAGTACATATACAAGTGTGATGG + Intronic
1040648319 8:49423864-49423886 TAGTCCCTTTGCAAGAGTGAAGG - Intergenic
1041651528 8:60307869-60307891 TAGTCCCTTTGAAAGAGTGAGGG + Intergenic
1041917214 8:63149700-63149722 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1042706398 8:71668651-71668673 TCATCCCTTTGCAAGAGTGAGGG - Intergenic
1043599168 8:81917785-81917807 TAATTCTTTTGCAAGAGTGAGGG - Intergenic
1043717635 8:83506803-83506825 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1043838005 8:85067053-85067075 TAGTCCTTTTGTAAGAGTGAGGG - Intergenic
1045189614 8:99869776-99869798 TAAAAGTTTTACAAGAGTGATGG - Intronic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1045853588 8:106734675-106734697 TAGTCCATTTGTAATAGTGATGG + Intronic
1045889999 8:107144630-107144652 TAATACTTTTACAATAGTTATGG - Intergenic
1046075146 8:109304535-109304557 TAGTGCCTTTGCAAGAGTGAGGG - Intronic
1046730921 8:117725454-117725476 TGGGCCTTTTACAGGAGCGATGG + Intergenic
1049909646 9:253060-253082 CAGTCCTTTTCCAGGAGGGATGG - Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050896312 9:10888597-10888619 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1052163385 9:25292015-25292037 TAGTCTTTTCGCAAGAGTGAGGG - Intergenic
1053059704 9:35021390-35021412 TAGTCCCTTTGCAAGGGTGAGGG + Intergenic
1053559953 9:39181803-39181825 TTGTACTTTTACAACAGTGCTGG + Intronic
1053824061 9:42002024-42002046 TTGTACTTTTACAACAGTGCTGG + Intronic
1054137163 9:61437152-61437174 TTGTACTTTTACAACAGTGCTGG - Intergenic
1054606513 9:67185340-67185362 TTGTACTTTTACAACAGTGCTGG - Intergenic
1055882007 9:81013136-81013158 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056324170 9:85462773-85462795 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1056653627 9:88490641-88490663 TAGTTCTTTAACCTGAGTGATGG - Intergenic
1057068490 9:92076104-92076126 CAGTCCTTTGCCAAGAGTTAGGG - Intronic
1057552726 9:96063831-96063853 AACTCATTTTACAAGAGAGAGGG - Intergenic
1058010701 9:99973643-99973665 TAGTCTTTTTACTAGGGTGATGG - Intergenic
1058025914 9:100142276-100142298 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1059539553 9:115117184-115117206 TATTCCTCTTACAACACTGATGG + Intronic
1061709034 9:132474868-132474890 CAATCCTTTTACAAGGGTCAGGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1187103489 X:16218567-16218589 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1188332726 X:28894203-28894225 TAGTACCTTTGCAAGAGTGCGGG + Intronic
1190125931 X:47705454-47705476 TAGTGCCTTTAGGAGAGTGAGGG + Intergenic
1191013915 X:55790076-55790098 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1191761623 X:64653402-64653424 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1191825892 X:65364235-65364257 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic
1192454955 X:71268760-71268782 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1192706439 X:73531802-73531824 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1192764185 X:74125696-74125718 TAGTCCCTTTGCAAGGGTGTGGG + Intergenic
1192913826 X:75633729-75633751 CAATCCTTTTGCAAGAGTGAGGG + Intergenic
1193537393 X:82731172-82731194 TAGTCCTTTTGCAAGAGTCAGGG - Intergenic
1194361365 X:92954557-92954579 TTGTACTTATACAAGAGTCATGG - Intergenic
1194660999 X:96628367-96628389 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1194873482 X:99160828-99160850 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1195016779 X:100788855-100788877 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1195290883 X:103431224-103431246 TAGTCCTTTTGCAAGAGCGAGGG + Intergenic
1195326588 X:103763454-103763476 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1196497102 X:116334652-116334674 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198619901 X:138495522-138495544 TAGTACTTTTTCTAGAGGGAGGG - Intergenic
1198966238 X:142230894-142230916 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1199377619 X:147132511-147132533 GAGTCCTTTTGCAAGAGCAAGGG + Intergenic
1200669561 Y:6070432-6070454 TTGTACTTATACAAGAGTCATGG - Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1200813150 Y:7505070-7505092 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1201061418 Y:10050059-10050081 TAGTCACCTTGCAAGAGTGAGGG + Intergenic
1201307210 Y:12561331-12561353 TAGTCCCTTTGCAAGAATGAGGG + Intergenic
1201365682 Y:13204337-13204359 CACTCCTATTCCAAGAGTGAAGG + Intergenic
1201724552 Y:17138414-17138436 TAGTCCCTTTGCAAGAGGGAGGG + Intergenic
1201937449 Y:19423470-19423492 TAGTCCTTTTGAAAGAGTGAGGG - Intergenic
1202062304 Y:20900207-20900229 TAGTCCCTTTGAAAGAGTGAGGG - Intergenic
1202076209 Y:21040299-21040321 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic