ID: 1093360898

View in Genome Browser
Species Human (GRCh38)
Location 12:18226413-18226435
Sequence CACATTGCTGCAACCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093360898 Original CRISPR CACATTGCTGCAACCTCTGG GGG (reversed) Intronic
901860663 1:12072453-12072475 CTCATCACTGCAAACTCTGGAGG - Intronic
903058987 1:20656289-20656311 CACAGAGCAGCACCCTCTGGGGG + Intronic
904988912 1:34575819-34575841 CTTGTTGCTGCACCCTCTGGAGG - Intergenic
905953370 1:41971932-41971954 CATGTTGCTGCGTCCTCTGGAGG - Intronic
907108070 1:51901910-51901932 CTTGTTGCCGCAACCTCTGGAGG - Intergenic
907825564 1:58013610-58013632 CTCCTTCCTGCAACATCTGGAGG + Intronic
908427332 1:64019982-64020004 CACATTGCTTCCTCCTCTGTGGG - Intronic
909863044 1:80632948-80632970 CCCATTGCTTAAACCTCTAGGGG - Intergenic
913364768 1:118025339-118025361 CATAGTGCTTCACCCTCTGGGGG + Exonic
914843926 1:151270072-151270094 CACATTGGAGCAAGCTCAGGAGG - Intergenic
915814328 1:158950609-158950631 CACTTTGCTGAAACCTCTCTAGG - Intronic
917354436 1:174111532-174111554 CTTGTTGCTGCATCCTCTGGAGG - Intergenic
918185421 1:182122419-182122441 CACCATGCTGCAAGCCCTGGAGG + Intergenic
919032734 1:192265104-192265126 CAAATAGCTGCTACTTCTGGGGG + Intergenic
919109365 1:193198455-193198477 CTTATTGTTGCATCCTCTGGAGG - Intronic
920783613 1:209019501-209019523 CAAACTGCTCCAACCTCTGCTGG - Intergenic
922455573 1:225771106-225771128 CTCAATGCTGCCTCCTCTGGGGG - Intergenic
922493989 1:226041709-226041731 TGCATTGCTTCAACCTCTGCTGG - Intergenic
922527053 1:226312049-226312071 CTCGTTGCTCCATCCTCTGGAGG + Intergenic
923001098 1:230006999-230007021 CACATCGCTCCATCCACTGGAGG + Intergenic
1062985287 10:1762741-1762763 CACATTACTGCAGGCTCTGAGGG - Intergenic
1063991283 10:11566629-11566651 CACATTGCAGCAAGCTCTGTTGG - Intronic
1065605758 10:27415860-27415882 CTTGTTGCTGCACCCTCTGGAGG - Intergenic
1065746084 10:28843666-28843688 CATATTGCTGCAGCTTCTTGTGG + Intergenic
1066600125 10:37095835-37095857 CACATTGTTGTAGGCTCTGGAGG - Intergenic
1067111732 10:43406216-43406238 CACATTTCTGCAGCCCCTGCAGG + Intronic
1070987501 10:80701088-80701110 CACACTGCAGCAACCTCTGTGGG + Intergenic
1072058548 10:91786145-91786167 CTTGTTGCTGCATCCTCTGGAGG - Intergenic
1072355762 10:94608844-94608866 CAAACTGTTGCAACTTCTGGCGG + Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1074775345 10:116763975-116763997 CACTTCCCTGCAACCTTTGGGGG + Intergenic
1084723976 11:70928478-70928500 CCCTTTGCTGCATCTTCTGGGGG - Intronic
1084764790 11:71301328-71301350 CACAGGGCTGCTTCCTCTGGAGG + Intergenic
1086307188 11:85493980-85494002 CTTGTTGCTGCATCCTCTGGAGG + Intronic
1090112298 11:123926624-123926646 CACATTTCTACAGCCTCTGCTGG - Intergenic
1091291945 11:134445484-134445506 CACATTGCTGCACCCTCTCTGGG - Intergenic
1092272776 12:7036914-7036936 TATACAGCTGCAACCTCTGGAGG - Intronic
1093360898 12:18226413-18226435 CACATTGCTGCAACCTCTGGGGG - Intronic
1094027473 12:25974132-25974154 TACATTGCTCCAACCTCAGTGGG - Intronic
1094802930 12:34058640-34058662 CTTACTGCTGCATCCTCTGGAGG - Intergenic
1095497679 12:42802437-42802459 CACATGCCTGCATTCTCTGGAGG - Intergenic
1095669692 12:44844048-44844070 CTTGTTGCTGCAGCCTCTGGAGG + Intronic
1101354409 12:103963962-103963984 CAGATTGCTAAAAGCTCTGGTGG + Intronic
1102040670 12:109798778-109798800 CACAGTGCTGCATGCGCTGGTGG - Exonic
1102854735 12:116283737-116283759 TGAATTGCTGCAACCTTTGGGGG - Intergenic
1105065458 12:133193512-133193534 CTTGTTGCTGCATCCTCTGGAGG + Exonic
1106427982 13:29651495-29651517 CATATTGCTGCATCCTCTGGAGG + Intergenic
1106785250 13:33101044-33101066 CACTTTAGTGCAACATCTGGGGG - Intergenic
1111063020 13:83047968-83047990 CACCTTGTTGCATCCTCTGGAGG - Intergenic
1113429682 13:110238972-110238994 CACACTGCCGCAGTCTCTGGAGG + Intronic
1114574372 14:23699195-23699217 CAAGTTGCTGCGACCTCTGGAGG - Intergenic
1114574735 14:23701544-23701566 TACATTGCTGCAACATCTGGAGG - Intergenic
1114721873 14:24891323-24891345 CACAGTGCTGCTCCCTCTGAAGG + Intronic
1115194607 14:30782819-30782841 CTTGTTGCTGCATCCTCTGGAGG + Intergenic
1116384961 14:44318635-44318657 CTTATTGCTGCATCCTCTGGAGG - Intergenic
1117238865 14:53807781-53807803 CACAAAGCAGCAACATCTGGAGG + Intergenic
1117963976 14:61188557-61188579 CACACTACAGCAACGTCTGGGGG - Intronic
1117964004 14:61188687-61188709 CACACTACAGCAACGTCTGGGGG - Intronic
1118449588 14:65888003-65888025 CTCATTGTTGCCACCACTGGGGG + Intergenic
1118688576 14:68315888-68315910 CACATTTCTTCAAACTCTGGGGG - Intronic
1119118713 14:72052859-72052881 CACATTGGAAGAACCTCTGGGGG - Intronic
1121169495 14:91841625-91841647 TACATAGCTGCCACTTCTGGAGG - Intronic
1122725030 14:103744898-103744920 CTCCTTGCTGCAACCCCTTGAGG + Intronic
1125840677 15:42798479-42798501 CATATGGCTGCATCCCCTGGGGG - Intronic
1126845926 15:52760623-52760645 CACAATGCTGCTCCCTCTGCAGG - Intronic
1134683464 16:16142511-16142533 CACAATGCTGCCCCCCCTGGGGG - Exonic
1138338444 16:56270914-56270936 CACATTGCAGCAGCCCCAGGTGG - Intronic
1139952287 16:70678251-70678273 CACCTTCCTGCAGCCTGTGGTGG - Exonic
1140303231 16:73778496-73778518 CATATTGCTGCTACCACTGAGGG - Intergenic
1140415265 16:74769976-74769998 CACTTTGCTGCACCCTCTGTAGG - Intronic
1140565094 16:76032310-76032332 CAAGATGCTGCATCCTCTGGAGG - Intergenic
1143525213 17:7467921-7467943 CAGCTTGCTCCAGCCTCTGGAGG + Intronic
1144430912 17:15191129-15191151 CCCACTGCTGAAACCTCTAGGGG + Intergenic
1148919627 17:51019135-51019157 CTTGTTGCTGCATCCTCTGGAGG - Intronic
1150473121 17:65454216-65454238 CGCGTTGCTGTATCCTCTGGAGG - Intergenic
1151747033 17:76017330-76017352 CACAATGCTGCAACCTCCCCAGG + Intronic
1152233976 17:79128940-79128962 CACAGTGAAGAAACCTCTGGTGG + Intronic
1153350688 18:4077965-4077987 CAGAATGCTGAAGCCTCTGGTGG + Intronic
1154121792 18:11658191-11658213 CACATTGCCTCAACCTCAGAAGG + Intergenic
1154987211 18:21564020-21564042 CAGATTGCTTCAACTTATGGAGG - Intronic
1155324140 18:24649249-24649271 CTTATTGCTGCATCCTCTGGAGG + Intergenic
1155497367 18:26455877-26455899 CTCTTTGCTGCAACCTCTCGAGG + Exonic
1157793712 18:50556829-50556851 TTCATGGCTGCATCCTCTGGAGG - Intergenic
1157806619 18:50663115-50663137 CACATTCCTGCAGCCTCTCTTGG + Exonic
1158949270 18:62476846-62476868 CTTGTTGCTGCAGCCTCTGGAGG + Intergenic
1159651992 18:70988496-70988518 CTTTTTGCTGCATCCTCTGGAGG + Intergenic
1159706091 18:71690377-71690399 CTAGTTGCTGCATCCTCTGGAGG - Intergenic
1166608056 19:44163083-44163105 CCAGTTGCTGCATCCTCTGGAGG + Intergenic
926423258 2:12718499-12718521 CTTATTGTTGGAACCTCTGGAGG + Exonic
929884941 2:45870119-45870141 CCCATTGCAGCTACCTCTGAAGG + Intronic
930490157 2:52058941-52058963 CACATTGCTGCAAGGGGTGGTGG - Intergenic
930610835 2:53541264-53541286 CAGATTGCAGCAAGCCCTGGAGG - Intronic
930693562 2:54388821-54388843 AACATTGCTGTTACCTCAGGAGG - Intergenic
930697504 2:54426948-54426970 CACATATCTGGAACCTCTGCTGG + Intergenic
931002832 2:57808037-57808059 CTTGTTGCTGCATCCTCTGGTGG - Intergenic
932516781 2:72359388-72359410 CTTATTGCTGCATCCTCTGGAGG - Intronic
932844369 2:75120197-75120219 CACCTTCCTGCAACCTGTGCAGG + Intronic
933613923 2:84464380-84464402 CACAAAGCTGGAACTTCTGGGGG - Intergenic
934154181 2:89179905-89179927 CACATTTCTGCAGGCTTTGGAGG - Intergenic
934532555 2:95103484-95103506 GACATTGATGCAACCTTTTGTGG + Intronic
936155181 2:110042512-110042534 CACAGTGCTGCTTCCTCTGTGGG + Intergenic
936189501 2:110328902-110328924 CACAGTGCTGCTTCCTCTGTGGG - Intergenic
936469206 2:112783608-112783630 CACATCTCTACAACCTCTGCCGG + Intronic
936818304 2:116487259-116487281 AACATTTCAGCAACATCTGGTGG - Intergenic
937070780 2:119061411-119061433 CTTATTACTGCATCCTCTGGAGG - Intergenic
938912876 2:135901508-135901530 CTTGTTGCTGCATCCTCTGGAGG - Intergenic
939455981 2:142436031-142436053 CCCGTTGCTGCAACCTCTGGAGG - Intergenic
940075967 2:149742759-149742781 CTTATTGCTGCATCCACTGGAGG + Intergenic
941092780 2:161197648-161197670 CTCATTGCTGCATCATCTAGTGG + Intronic
941957385 2:171218662-171218684 CTTGTTGCTGCATCCTCTGGGGG + Intronic
946121339 2:217517726-217517748 GTGATTGCTGCAACCTCTGAAGG + Intronic
947401700 2:229736888-229736910 CCCACTGCTGCCACCACTGGAGG + Intergenic
948533165 2:238626410-238626432 CACATTCCAGCAAGCTCTGTAGG - Intergenic
1169278091 20:4246956-4246978 CCCATGGCTGCAACCTCCGCAGG - Intronic
1169877153 20:10310702-10310724 CTTATTGCTGCATCCTCTGGAGG + Intergenic
1172538154 20:35690125-35690147 CAGCTCTCTGCAACCTCTGGAGG - Intronic
1172573589 20:35989321-35989343 CACATTGGTCCAGGCTCTGGAGG + Intronic
1173401837 20:42733042-42733064 CACAATGATGCAACCTCATGTGG + Intronic
1175176568 20:57115913-57115935 AACCTTGCTGCAACCTCTGATGG - Intergenic
1175237252 20:57523806-57523828 CACACTGCTGCAGGCTCTGCCGG + Exonic
1178504351 21:33150973-33150995 GACATTGCTGCAACCTGTCTCGG - Intergenic
1179121983 21:38556481-38556503 CACATTTCTGCAGCCTTTTGTGG + Intronic
1179545659 21:42111054-42111076 CACATTGCTGCCCCCTCTTCTGG - Exonic
1180865988 22:19120188-19120210 AACATTGCAGCTACCCCTGGAGG - Intronic
1180888615 22:19268201-19268223 CCTGTTGCTGCATCCTCTGGAGG - Intronic
1181335757 22:22126393-22126415 CACCTTTCTGCAGTCTCTGGAGG + Intergenic
1181453153 22:23037465-23037487 CACATTCCTGCACCCTCAGACGG + Intergenic
1181829563 22:25549087-25549109 CAAATTGCTGCAAGCCATGGTGG + Intergenic
1183677746 22:39309252-39309274 CTACTTGCTGCAACTTCTGGGGG - Intergenic
1184421848 22:44386738-44386760 CACTGTGCTGCAGCCTCTGTGGG + Intergenic
950537844 3:13591049-13591071 CACATTTCTGCCAACTCTGGCGG + Intronic
950964235 3:17135026-17135048 CACATTGCTACATCATCTTGAGG + Intergenic
951048467 3:18067504-18067526 CTCGTTGCTGCATCCTCTGGAGG - Intronic
951478624 3:23135500-23135522 CTTATTGCTGCATCCTCTAGAGG + Intergenic
951626321 3:24667684-24667706 CATGTTGCTGTATCCTCTGGAGG - Intergenic
952436231 3:33275362-33275384 CTTGTTGCTGCATCCTCTGGAGG + Intergenic
953388235 3:42519214-42519236 CATCTTGCTGCAGCCTATGGGGG - Exonic
955353262 3:58209653-58209675 CACCTTGCTGCAGGCTCTGCTGG + Intronic
957057959 3:75458817-75458839 CCCATTGCTCAAACCTCTAGGGG + Intergenic
958751852 3:98201273-98201295 CTTCTTGCTGCATCCTCTGGAGG + Intergenic
960062770 3:113340593-113340615 CCCATTGCTCAAACCTCTAGGGG + Intronic
960590055 3:119356976-119356998 GAGATTGATACAACCTCTGGAGG - Intronic
961374843 3:126457283-126457305 CACAGTGTTGCATCCTCTGGCGG - Intronic
964222485 3:154363447-154363469 CCCATTGCTGCAGCCTCCAGAGG + Intronic
965490027 3:169324046-169324068 CACATTCCTGCAAGCCATGGAGG - Intronic
968211040 3:196849041-196849063 AACATTTCAGCAACATCTGGTGG + Intergenic
969001802 4:3988693-3988715 CCCATTGCTCAAACCTCTAGGGG + Intergenic
969085979 4:4656698-4656720 CTTCTTGCTGCATCCTCTGGAGG - Intergenic
969292576 4:6249690-6249712 GACCTTCCTGCAACCTGTGGGGG - Intergenic
969812112 4:9656118-9656140 CCCATTGCTCAAACCTCTAGGGG - Intergenic
971147906 4:23999287-23999309 CACCTTGCTGGCAACTCTGGGGG - Intergenic
971683464 4:29732649-29732671 CATATTGCTTCATCCTCTGCAGG - Intergenic
972182715 4:36488770-36488792 CTTATTGCTGCATCCTCTGGAGG + Intergenic
973057401 4:45678501-45678523 CACACTGCTCAAACCTCTAGGGG + Intergenic
973705416 4:53575800-53575822 TCCATTGCTGCCACCTCTGGAGG - Intronic
976425724 4:84901039-84901061 CTTGTTGCTGCATCCTCTGGAGG + Intronic
976469420 4:85410540-85410562 TTCATTACTGCATCCTCTGGAGG - Intergenic
976772414 4:88667940-88667962 CTCATGGCTTCAACATCTGGTGG - Exonic
978413602 4:108452123-108452145 CACATTTATACAACCCCTGGAGG + Intergenic
979288285 4:118951282-118951304 CTTGTTGCTGCATCCTCTGGAGG + Intronic
980689760 4:136280246-136280268 CATAATGCTGCATTCTCTGGTGG - Intergenic
980877161 4:138673096-138673118 CACATTGCAGCAAAGTCGGGGGG - Intergenic
981638776 4:146911783-146911805 AACATTCCTGCAACCACTAGCGG + Intronic
982423093 4:155221220-155221242 CTTATTGCTGCAACCTCCGGAGG - Intergenic
983208673 4:164936460-164936482 TTCAATGCTGCAGCCTCTGGAGG - Intergenic
983780371 4:171663169-171663191 CCTATTTCTGCAACCTCTGGGGG - Intergenic
986790453 5:11154567-11154589 CTCAGTGCTGCATCCTCAGGCGG + Intronic
986988961 5:13529519-13529541 TAAATTTCTGCAATCTCTGGAGG + Intergenic
987387660 5:17345302-17345324 CAAATTGCTGCCTCCTTTGGGGG + Intergenic
987817513 5:22922128-22922150 CTTATGGCTGCATCCTCTGGAGG + Intergenic
989450983 5:41586565-41586587 TGCATTGCTGAAACTTCTGGAGG - Intergenic
989954258 5:50338265-50338287 CTTGTTGCTGCATCCTCTGGAGG + Intergenic
990507176 5:56456194-56456216 CACATGGCTGCCAGCTCTGAAGG + Intergenic
991399467 5:66237928-66237950 CACCTTGCTGCATGCACTGGAGG - Intergenic
992458093 5:76934681-76934703 CCCATTGCTGCCTCCTCTGAAGG - Intergenic
993023358 5:82618446-82618468 CCTATTGCTGCATCCTCTAGAGG + Intergenic
993191156 5:84683749-84683771 CTTAGTGCTGCACCCTCTGGAGG + Intergenic
994301866 5:98157168-98157190 CCCACTGCTGGAACCTCTAGGGG + Intergenic
994322128 5:98406037-98406059 CACATAGCTGTACCCTCTGCAGG + Intergenic
998362040 5:141596425-141596447 CAGCTTGCTGCAACCTCTGGGGG - Intronic
999041589 5:148419617-148419639 CACATGCCTGTAACCTCAGGAGG + Intronic
1001364523 5:171123186-171123208 CACATGGGTGCTAGCTCTGGTGG - Intronic
1004352850 6:14905421-14905443 CTTGTTGCTGCAACCTCTGGAGG - Intergenic
1017530849 6:155290913-155290935 CTCATTACTGTAAACTCTGGGGG - Intronic
1019322978 7:424048-424070 CACAGGGCTGCAAAGTCTGGGGG - Intergenic
1021411713 7:20336369-20336391 CAATTTGCTGCACCTTCTGGAGG - Intronic
1022421712 7:30229749-30229771 CTTGTTGCTGCATCCTCTGGAGG + Intergenic
1022787464 7:33652758-33652780 AAAATTCCAGCAACCTCTGGGGG - Intergenic
1024643813 7:51355104-51355126 CCCATTGCTCAAACCTCTAGGGG + Intergenic
1027220926 7:76213492-76213514 TACCTTGGTGCAACCTCTGTGGG - Intronic
1027279297 7:76594150-76594172 CACAGTGTTCCAACCTCTGCCGG + Intergenic
1031210077 7:118813076-118813098 CACATAGCTCTAATCTCTGGGGG + Intergenic
1032364594 7:131287359-131287381 CACACTCCTGAAAGCTCTGGGGG + Intronic
1032832791 7:135645298-135645320 CACCTTGCTGCTTCCTCTTGAGG + Intronic
1034657878 7:152743768-152743790 CACGTTGCTGTGACCTCCGGAGG + Intergenic
1036026975 8:4919877-4919899 CTTGTTGCTGCACCCTCTGGAGG - Intronic
1037538644 8:19851233-19851255 CTCCTTGCTGCTGCCTCTGGAGG + Intronic
1038159719 8:25025096-25025118 CTGATTGCTGCATCCACTGGAGG + Intergenic
1038242555 8:25823376-25823398 AACATTGCTGCCAGCTCTGATGG + Intergenic
1038789379 8:30655124-30655146 CAGCTTACTGCAACCTCTGCTGG - Intronic
1039545616 8:38408866-38408888 CAGATTGCTGCAGCCTCTGCAGG - Intronic
1040498360 8:47986625-47986647 CGGAATGCTGCATCCTCTGGAGG + Intergenic
1041016660 8:53598298-53598320 CTTGTTGCTGCATCCTCTGGAGG + Intergenic
1041402445 8:57460008-57460030 CACTTTGCTAAAACCTCTGAAGG + Intergenic
1044160882 8:88913597-88913619 CACACTGTAGCAACCTGTGGAGG + Intergenic
1046115756 8:109781428-109781450 CAGGTTGCTGCAACTTCTTGAGG + Intergenic
1046262558 8:111788048-111788070 CTTGTTGCTGCATCCTCTGGAGG + Intergenic
1046268557 8:111862510-111862532 TCTGTTGCTGCAACCTCTGGAGG + Intergenic
1048052335 8:130829832-130829854 GACATTTCAGCAACATCTGGTGG + Intronic
1049546553 8:143234405-143234427 CCCAGTGCTGAGACCTCTGGCGG + Intergenic
1049854172 8:144851229-144851251 GCCATTGCTGCCACCTCTGGAGG + Exonic
1049910149 9:258030-258052 AACACTGCTTCAACCTGTGGGGG - Intronic
1050479348 9:6073702-6073724 CCCATTGCTCAAACCTCTAGGGG - Intergenic
1055376680 9:75656029-75656051 CTTGTTGCTGCACCCTCTGGAGG - Intergenic
1056617548 9:88181290-88181312 CTCTTTGCTGCAACCTCTCGAGG - Intergenic
1057816113 9:98296251-98296273 TGGATTGCTGCATCCTCTGGAGG - Intronic
1058339133 9:103872933-103872955 CCCATTGCTCAAACCTCTAGGGG + Intergenic
1060666767 9:125436473-125436495 CACACGGCTGCCACCTGTGGAGG + Intergenic
1061304081 9:129722667-129722689 CACCTTCCTGCAACCTTTTGGGG - Exonic
1061639173 9:131937894-131937916 CAGCTCACTGCAACCTCTGGAGG + Intronic
1186232826 X:7474246-7474268 AACATTTGTGCAATCTCTGGAGG + Intergenic
1187612399 X:20956627-20956649 CTTGTTGCTGCATCCTCTGGAGG + Intergenic
1188685649 X:33066553-33066575 CACATTGCTGGTACCGTTGGGGG - Intronic
1189380096 X:40496499-40496521 CTTGTTGCTGCATCCTCTGGAGG - Intergenic
1189426666 X:40907949-40907971 GAGATGGCTGCAACCTCTGTAGG - Intergenic
1189685068 X:43555464-43555486 CACCTTGCTGCACCCTGAGGAGG - Intergenic
1190398937 X:50012345-50012367 CACTTTCCTTCAAGCTCTGGTGG - Intronic
1190918124 X:54825059-54825081 CACATGGCTTCAACCTTGGGAGG + Intergenic
1192575677 X:72241392-72241414 CTTGTTGCTGCATCCTCTGGAGG - Intronic
1194490828 X:94546893-94546915 CTTATTGCTGCATCCTCTGAAGG - Intergenic
1194752271 X:97698212-97698234 CATGTTTCTGCAACCTCTGGAGG + Intergenic
1194752323 X:97698764-97698786 CATGTTGCTGCATCCTCTGGAGG - Intergenic
1195539170 X:106042844-106042866 AGCATTGCTGCAACCTGTGGTGG - Intergenic
1195689066 X:107609151-107609173 CACATTGCCACATACTCTGGGGG - Intergenic
1195714940 X:107809462-107809484 CACATTGCCACATACTCTGGGGG - Intergenic
1195854336 X:109313972-109313994 CTTATTGCTGCATCTTCTGGAGG + Intergenic
1197536019 X:127690190-127690212 CACAATGCTGCCACTGCTGGGGG + Intergenic
1198232043 X:134699357-134699379 CTTATTGCTGCATCCTCTGGAGG - Intronic
1199286738 X:146062474-146062496 CTTATTGCTGCATCCACTGGAGG - Intergenic
1199493626 X:148428349-148428371 CTGAATGCTGCATCCTCTGGAGG + Intergenic