ID: 1093362352

View in Genome Browser
Species Human (GRCh38)
Location 12:18246243-18246265
Sequence GCTTCCCAATGAAGCATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093362348_1093362352 9 Left 1093362348 12:18246211-18246233 CCAAAACATGATAGCTGGCTGGC 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1093362352 12:18246243-18246265 GCTTCCCAATGAAGCATAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093362352 Original CRISPR GCTTCCCAATGAAGCATAGC TGG Intronic
902756129 1:18550350-18550372 GCTTCCCAAGGAGGCAGAGGTGG - Intergenic
903705524 1:25282771-25282793 GGTTCCCACTGAAGCACAGGAGG + Intronic
903721706 1:25410549-25410571 GGTTCCCACTGAAGCACAGGAGG - Intronic
910533644 1:88270763-88270785 GCTTTCCTATAAAGCATAGAGGG + Intergenic
911046390 1:93632208-93632230 CCTTCCCAATAATGCATAACAGG - Intronic
916717255 1:167455945-167455967 GCTTCCCAAGGAGGCAGCGCCGG - Intronic
917033446 1:170720389-170720411 GCTGCCCAAAGAAACACAGCTGG - Intronic
923497899 1:234540878-234540900 GCTTCCCTGTGAAGCATCTCTGG - Intergenic
924001091 1:239553358-239553380 GGTTCCCACGGAAGCATAGTAGG - Intronic
1064351238 10:14579235-14579257 GTTTCCAAATGATGCTTAGCTGG - Intronic
1068600234 10:58949122-58949144 TCTTCCCGATGAAGCAGGGCAGG + Intergenic
1069133132 10:64731194-64731216 GCTTTACAATGAATCATAGGTGG - Intergenic
1075171537 10:120120478-120120500 GCTTCCCAAAGGAGCAAAACTGG - Intergenic
1075492654 10:122885984-122886006 GCTGCCCAAGGAAACATGGCAGG - Intergenic
1075498228 10:122946913-122946935 GCTGCCCAAGGAAACATGGCAGG + Intronic
1077454767 11:2671909-2671931 GCTGCCTGAGGAAGCATAGCGGG - Intronic
1078437750 11:11339470-11339492 GCTCACCAGTGAGGCATAGCAGG - Intronic
1082251309 11:49983899-49983921 GCTTCTCAATGAAGCATGTGTGG - Intergenic
1082558401 11:54590107-54590129 GCTTCTCAATGAAGCATTTGTGG + Intergenic
1083180828 11:60984002-60984024 CCTTCCCAGTGAATCATATCAGG + Intronic
1088878941 11:113958378-113958400 GCTGCCCAAAGAAGCAGAGTAGG - Intergenic
1092971301 12:13697978-13698000 GCTACCCAATGGAGAAGAGCAGG - Intronic
1093362352 12:18246243-18246265 GCTTCCCAATGAAGCATAGCTGG + Intronic
1094460954 12:30696133-30696155 GCTTCCAAATTAAGCATATCTGG + Intergenic
1106886438 13:34189958-34189980 GATTCCAAATTAAGCATAACTGG - Intergenic
1107225614 13:38044741-38044763 GCTGCCCAGTGAAGAGTAGCAGG - Intergenic
1107526979 13:41242614-41242636 TCTTACAAATGAAGCATTGCTGG + Intronic
1111892928 13:94105939-94105961 CCTTTCCAATGTAGGATAGCTGG - Intronic
1111892936 13:94105986-94106008 CCTTTCCAATGTAGGATAGCTGG - Intronic
1111892944 13:94106033-94106055 CCTTTCCAATGTAGGATAGCTGG - Intronic
1111892952 13:94106080-94106102 CCTTTCCAATGTAGGATAGCTGG - Intronic
1111892960 13:94106127-94106149 CCTTTCCAATGTAGGATAGCTGG - Intronic
1111892968 13:94106174-94106196 CCTTTCCAATGTAGGATAGCTGG - Intronic
1113232453 13:108228802-108228824 GCTTCTCAATGTAGAAGAGCTGG - Intronic
1118822614 14:69354996-69355018 GCTACCCAATCAAGCAAAGCTGG - Exonic
1120682016 14:87491114-87491136 GCAACTAAATGAAGCATAGCTGG - Intergenic
1123218934 14:106839144-106839166 GCTTCCGAAGTAAGCAGAGCCGG + Intergenic
1125481838 15:40086557-40086579 GCCTCCCAATGCCACATAGCTGG + Intergenic
1125744911 15:41991467-41991489 TCCTCCCTATGAAGCAGAGCAGG - Intronic
1127630097 15:60820096-60820118 GTTTCCCAATCAAAGATAGCAGG - Intronic
1128410863 15:67395651-67395673 CCTACCCAATGAAGAATAGGTGG + Intronic
1128502007 15:68233228-68233250 GGTTTCCAAAGAAGCAGAGCAGG - Intronic
1129330655 15:74825618-74825640 GCTTCCCAGTGATGCAAAGCAGG - Exonic
1132804230 16:1768323-1768345 GGTGCCCATGGAAGCATAGCTGG - Exonic
1133281642 16:4669825-4669847 ACTTCCCAATGCAGCATCCCAGG - Intronic
1138252563 16:55513816-55513838 TCTTCCCAATGAGGCATTCCAGG - Intronic
1138360421 16:56423878-56423900 GCTTCCTGATGAAGCACAGTGGG + Intronic
1141017239 16:80461913-80461935 GCCTCCCAAGTCAGCATAGCTGG - Intergenic
1141478636 16:84291568-84291590 GCTTCCCTGTGAAACATGGCTGG - Intergenic
1144616939 17:16785023-16785045 TCTTCCCAATGCAGCATATCTGG + Intronic
1144895752 17:18530651-18530673 TCTTCCCAATGCAGCATATCTGG - Intergenic
1145136465 17:20413581-20413603 TCTTCCCAATGCAGCATATCTGG + Intergenic
1149420986 17:56510804-56510826 GCTTTCCCAGGAAGCCTAGCGGG - Intronic
1150183854 17:63158778-63158800 GAATCCAAATGCAGCATAGCAGG + Intronic
1152625377 17:81385745-81385767 GCTTCCCACTGAAGACTTGCTGG - Intergenic
1154470245 18:14693507-14693529 CCTACCCAGTGAGGCATAGCAGG + Intergenic
1166645911 19:44531521-44531543 TTTTCCCAATGAACCATGGCTGG - Intergenic
925129435 2:1483970-1483992 GCATCCAAATGAAGCATAATAGG - Intronic
926144028 2:10385938-10385960 GCTTCCCAAACAGGCAGAGCAGG - Intronic
927468787 2:23356920-23356942 GCTTCCGAATCCAGCATGGCAGG + Intergenic
927645207 2:24873021-24873043 GCTTCCCAACAAAGCAAGGCTGG + Intronic
932875905 2:75451602-75451624 TCTTCCCAATGCACCATATCAGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
934958439 2:98645422-98645444 TCTTACCAATGAAGCCCAGCTGG + Exonic
935754324 2:106265277-106265299 GTTTCCCAGTCAAGCATTGCTGG + Intergenic
937228466 2:120383311-120383333 CCTGCCCAATGCTGCATAGCAGG - Intergenic
938377952 2:130820748-130820770 GCTCCCCAAGGAGGCATAGCGGG + Intergenic
939079960 2:137647798-137647820 GCTTCACAAACAAGCACAGCTGG - Intronic
940567264 2:155382901-155382923 GGTTCCCATGGCAGCATAGCAGG + Intergenic
944893420 2:204140435-204140457 ACTGCCCAAGGACGCATAGCAGG - Intergenic
1170040353 20:12033765-12033787 GGTTCCCAATGCAGCAGAACTGG + Intergenic
1175726051 20:61319354-61319376 GCTTCCCGGTGGAGCATAACAGG - Intronic
1176256187 20:64154399-64154421 GCCTCCCTTTGAAGCCTAGCAGG + Intronic
1176804250 21:13464359-13464381 CCTACCCAGTGAGGCATAGCAGG - Intergenic
955666518 3:61355131-61355153 GCTTCCCACTCAAGCTTTGCTGG + Intergenic
956704733 3:71989550-71989572 GCTTCACAATGAAACACAGCAGG - Intergenic
958456039 3:94332576-94332598 GCTTCCCATTGTATCATATCAGG + Intergenic
958658981 3:97041682-97041704 ACTTCCTCAGGAAGCATAGCTGG + Intronic
961338915 3:126204233-126204255 GGTTCCACAGGAAGCATAGCTGG + Intergenic
973125663 4:46581057-46581079 GTTTGACAGTGAAGCATAGCAGG - Intergenic
974919629 4:68222826-68222848 GTTTCACAAAGAAACATAGCAGG + Intergenic
977069029 4:92359736-92359758 GCCTCCCAAGCAAGCAGAGCAGG - Intronic
983250688 4:165342746-165342768 GCTTCCAAATCAAGAAAAGCCGG + Exonic
987350941 5:17021244-17021266 ACCTCCCAATTAAGCATAACAGG - Intergenic
989195208 5:38709558-38709580 GCTTTGAAATGAAACATAGCTGG + Intergenic
992739562 5:79759619-79759641 GCTTCCTGATGAATCAGAGCTGG + Intronic
996294761 5:121898569-121898591 TCTACCCAACCAAGCATAGCTGG + Intergenic
999188786 5:149731423-149731445 GCTTCCCAATGACCCGCAGCCGG - Intronic
999690454 5:154141706-154141728 GCAGCCCAATGAAACAGAGCTGG + Intronic
1001049543 5:168403450-168403472 GCTGCCCAAAGAAGCTTAGCTGG - Intronic
1004269330 6:14179809-14179831 TCTTCCCCAGGAAGCAGAGCTGG - Intergenic
1009721697 6:67480223-67480245 GCATCAGAATGAATCATAGCTGG + Intergenic
1012118210 6:95331479-95331501 CCTTCCCATTGAATCTTAGCTGG - Intergenic
1012801069 6:103829081-103829103 GCTTCCCAATGAAACAGACAAGG + Intergenic
1016676521 6:146776695-146776717 GCTGCCCCATGAAGCATTTCTGG - Intronic
1019309457 7:353131-353153 GCTTCCCAAGGGGCCATAGCAGG - Intergenic
1020761347 7:12270668-12270690 GGCTCCCTATGAAGCACAGCTGG - Intergenic
1023227346 7:37984481-37984503 GCTTCCCACTAAAACACAGCAGG - Intronic
1023295636 7:38712626-38712648 ACAGCCCCATGAAGCATAGCAGG + Intergenic
1034379680 7:150679939-150679961 GCTTCCCAATCTAGCAAGGCAGG + Intergenic
1041967492 8:63696625-63696647 GCTTCCCAATGAAGGAAACCAGG - Intergenic
1044753105 8:95435075-95435097 GCATCCCAAAGAAGGATAACTGG + Intergenic
1045043376 8:98248943-98248965 TCTTCACAGTGAAGCATAGACGG + Intronic
1047013341 8:120696253-120696275 CCTTCCCCATGAAGCATCCCTGG - Intronic
1059490906 9:114666648-114666670 GCCTCCCAGTGAGGCATGGCTGG + Intergenic
1060675806 9:125513535-125513557 CCTTCCCAAGGATGCATAGCTGG - Intronic
1195131026 X:101852410-101852432 ACTTCCCAATAAAGAAAAGCTGG + Intronic
1198092466 X:133345195-133345217 GCTTCCCAATCATGTAGAGCTGG - Intronic