ID: 1093363133

View in Genome Browser
Species Human (GRCh38)
Location 12:18257040-18257062
Sequence CTCTTTCTGATAGTTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093363133_1093363138 16 Left 1093363133 12:18257040-18257062 CCTGACACAACTATCAGAAAGAG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 1093363138 12:18257079-18257101 ATTGCATGCTTTAATCTTTAAGG 0: 1
1: 0
2: 0
3: 24
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093363133 Original CRISPR CTCTTTCTGATAGTTGTGTC AGG (reversed) Intronic
901411229 1:9085688-9085710 TTCATTCAGATGGTTGTGTCGGG + Intronic
902123088 1:14184435-14184457 TTCTTTCTGTTATTTGTGTTCGG + Intergenic
903005066 1:20293018-20293040 CACCTTCTGAGAGCTGTGTCTGG - Intronic
904410048 1:30319820-30319842 CTCTGTCTGATGATTGTTTCTGG + Intergenic
908039777 1:60098598-60098620 TTCTTACTGATATTTTTGTCAGG + Intergenic
908491586 1:64649680-64649702 CTCTTACTGATAGTGGTATCAGG + Intronic
909483875 1:76153083-76153105 CTCCTTTTAATAGTGGTGTCTGG + Intronic
913521794 1:119651567-119651589 ATCTTTCAGAGAGTTGAGTCTGG + Intergenic
919511245 1:198467486-198467508 CTCATGCTGACAGCTGTGTCTGG + Intergenic
920154626 1:203938531-203938553 TTATTTCTGAAAGCTGTGTCTGG + Intergenic
920173108 1:204083807-204083829 CACTTTCTCCAAGTTGTGTCAGG - Intronic
920818369 1:209356612-209356634 CTCTTTCTTACACTTGAGTCAGG + Intergenic
922583391 1:226715617-226715639 CTCAATCTGATATTTGTGTTTGG - Intronic
1065112694 10:22455364-22455386 TTCTTTCTGAGGGTTGTTTCCGG - Intergenic
1066318487 10:34274433-34274455 CTCTTTCTGCTAGTGATTTCTGG - Intronic
1067085520 10:43236009-43236031 CTCTTTCTCATTGGGGTGTCAGG - Intronic
1067550004 10:47227492-47227514 CTCTTTCTTATAGCTGAGCCTGG - Intergenic
1069648552 10:70024011-70024033 CTCTTTCTGATTGCTCTGGCTGG - Intergenic
1072623276 10:97094965-97094987 CTCTTTCTGGCAGTTGGGACAGG - Intronic
1074264429 10:111887478-111887500 CTTTTTCTGACAGTTAAGTCAGG + Intergenic
1074452046 10:113567360-113567382 TGCTTTCTGATGGTTGTGGCTGG - Intronic
1078325161 11:10374769-10374791 TTCTCTCTGAGAGATGTGTCAGG - Intronic
1079425427 11:20337492-20337514 CTCTTGCTGATTATTTTGTCTGG + Intergenic
1079623859 11:22591743-22591765 ATCTTTCTGACAGATGTGACAGG + Intergenic
1082139377 11:48590174-48590196 CTCTTGCTGATGGCTGTGACTGG + Intergenic
1085366106 11:75946676-75946698 CTCTTGCTGATAGTGGTCTGAGG + Intronic
1086394864 11:86404378-86404400 CTGTACCTGCTAGTTGTGTCAGG + Intronic
1086442486 11:86842662-86842684 CTCTTTCTCACAGTTGTGAATGG - Intronic
1088991969 11:114961396-114961418 CTGTTTCTAAGAGTTATGTCTGG + Intergenic
1092190319 12:6514842-6514864 CACGTTCTGCTAGTTCTGTCAGG - Exonic
1092964530 12:13628704-13628726 TTCTTTCTGATACTTCTGTATGG - Intronic
1093284037 12:17235239-17235261 ATCCTTCTGACAGCTGTGTCAGG - Intergenic
1093363133 12:18257040-18257062 CTCTTTCTGATAGTTGTGTCAGG - Intronic
1100209587 12:92387736-92387758 CTCTTTCTGATTGGTGAGCCTGG - Intergenic
1101779461 12:107822773-107822795 GTCTTTCTGATTGGTGAGTCTGG - Intergenic
1104243226 12:127011598-127011620 CTCATTCTATTAATTGTGTCTGG - Intergenic
1104593359 12:130102479-130102501 CTCTTTTTGAGAGTGGTGTTGGG - Intergenic
1106375243 13:29180353-29180375 TTCTTTATGATACTTGTGTTTGG - Intronic
1108782123 13:53849025-53849047 CTCTTCCTGATAGTAATGTGGGG - Intergenic
1109890870 13:68612753-68612775 CACTTTCTGATAGCCGTATCTGG + Intergenic
1110013247 13:70365677-70365699 GTTTTTCTGGTAGCTGTGTCAGG - Intergenic
1111437570 13:88230562-88230584 CACATTTTCATAGTTGTGTCTGG - Intergenic
1112269649 13:97956835-97956857 CCCTTTCTGGTGGTAGTGTCCGG + Intronic
1114827798 14:26102756-26102778 CTGTCTCTGACAGTTGGGTCAGG + Intergenic
1116083701 14:40207237-40207259 GTTTTTGTCATAGTTGTGTCAGG + Intergenic
1116144479 14:41046534-41046556 GTCTTTCTGATCTTTATGTCTGG + Intergenic
1116664079 14:47752440-47752462 ATTTTTCTGATAGTTTTATCAGG - Intergenic
1117022728 14:51588407-51588429 CTCTCTCTGCTAGTTTTGTTAGG - Intronic
1119538964 14:75426891-75426913 CTCCTTCTGAGAGTGATGTCAGG - Intergenic
1121012480 14:90528774-90528796 CTGTTTCTGATGGTTGTTTCTGG + Exonic
1121602185 14:95213545-95213567 CCCTTTCTGATGGCTGTGGCAGG + Intronic
1129335928 15:74852217-74852239 CTGTTTCTGTTTGTTGTGTCTGG - Intronic
1129336954 15:74858083-74858105 CTCTTTCTGAAAGATGTGCGTGG + Intronic
1129997338 15:80017824-80017846 CTCTTTTTCAGTGTTGTGTCCGG - Intergenic
1131410982 15:92208256-92208278 GTCTTTCTGATTGGTGAGTCTGG - Intergenic
1131600646 15:93845572-93845594 CTCTTTCATATAATTGAGTCAGG - Intergenic
1131971586 15:97899023-97899045 CTCTCTCTGATAGCTGTGACAGG + Intergenic
1133898001 16:9947718-9947740 CTCTTTCTCTTACTGGTGTCTGG + Intronic
1135831903 16:25781820-25781842 CTCTTTCGGGTGGTTGTGTGGGG + Intronic
1135882313 16:26269916-26269938 CTCTTCCTGATTGTGGTGTGTGG - Intergenic
1136985199 16:35096706-35096728 CTCTTTTAGATTGTTTTGTCTGG + Intergenic
1137379631 16:47985517-47985539 CTATCTCTCATAGTTCTGTCTGG - Intergenic
1139045964 16:63060663-63060685 CTCCTTCTGAAGGTAGTGTCTGG + Intergenic
1139501149 16:67366900-67366922 CTCTTCCTGAGAGGTGTTTCTGG + Intronic
1139510302 16:67424415-67424437 CTTTTTCAGATAATTGTGTCAGG - Intergenic
1141873157 16:86803489-86803511 CTCATTCTGACAGTGGTCTCTGG - Intergenic
1142907323 17:3052849-3052871 CTCTTTCTCATACTTGCTTCTGG + Intergenic
1142927241 17:3251392-3251414 CTCTTTCTCATACTTGCTTCTGG - Intergenic
1144327729 17:14197793-14197815 CTCTTTGTGGTTGTTCTGTCAGG + Intronic
1146885755 17:36469750-36469772 TTCTTTCTGATGGCTGAGTCTGG + Intergenic
1149939175 17:60844701-60844723 CTCTTTATGTCAGTTGTGGCTGG + Intronic
1150558390 17:66274331-66274353 CTCTTTCTGATACTTATGCATGG - Intergenic
1150932383 17:69599236-69599258 ATCTATCTCATAGTTGTGTGAGG + Intergenic
1153672876 18:7429129-7429151 TTCTCTCTGACAGTTGTTTCTGG + Intergenic
1156818712 18:41343740-41343762 TGCTTTCTAATAGTTGTGTAGGG + Intergenic
1159552478 18:69909645-69909667 CTCTTGCTGTTAGTTTTTTCTGG - Intronic
1162160631 19:8712327-8712349 CTTTTTCTGGTTGTAGTGTCAGG + Intergenic
925854919 2:8120068-8120090 CTATTTCTGAGAATTTTGTCAGG - Intergenic
926875560 2:17473558-17473580 TTCTTTGTGGCAGTTGTGTCTGG - Intergenic
927374526 2:22398156-22398178 CTCATTCTAATAATTGTGTTAGG + Intergenic
929664706 2:43824708-43824730 CTCATTCTGATAGTCATCTCTGG + Intronic
929684331 2:44021286-44021308 CTCTCTCTGCTGATTGTGTCCGG - Intergenic
929720554 2:44362987-44363009 CCATTTCTGACAGTTGTGTTTGG + Intronic
930930956 2:56881880-56881902 CTCTTCCTGAAAGTTGTCTTGGG + Intergenic
931303645 2:61006559-61006581 CTCTTACAGATAGTTGTGGTGGG + Exonic
931321514 2:61177822-61177844 CTCTTTTTGAAAGTTGGGTTGGG + Exonic
932096699 2:68856605-68856627 TTCTTTCTGATAGTCGTGAGGGG + Intergenic
933670475 2:85002725-85002747 CTCTTTGTGATAGCTCTGTATGG + Intronic
935139315 2:100338683-100338705 CTCTTTCTGGGATGTGTGTCTGG + Intergenic
936651409 2:114430736-114430758 CTCTTTCTGAAAGTTATATTTGG - Intergenic
936786936 2:116104814-116104836 CTCTTTCTGAAACTTCTGTATGG + Intergenic
939795543 2:146640179-146640201 TTCTTTCTGATAGGTCTATCTGG - Intergenic
939887926 2:147701400-147701422 CTCTTTCACAGAGTTATGTCAGG + Intergenic
942864707 2:180659335-180659357 CTCTTACTGGTAGGTGTATCAGG - Intergenic
945787076 2:214254096-214254118 CTCTGTCTGTTATTGGTGTCTGG + Intronic
946092443 2:217241005-217241027 TTCTTTCTGATAGTGGTTTTGGG + Intergenic
1170436317 20:16333279-16333301 CTCTTTCAGAAAGGTGTGCCTGG + Intronic
1170981385 20:21217441-21217463 CTCTTTATAATAGTTCTGTTGGG + Intronic
1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG + Intergenic
1172228710 20:33322729-33322751 CTCTTTCTGATAAAGGTCTCTGG - Intergenic
1172862479 20:38065781-38065803 CTCTTTATGCTTGTTTTGTCAGG + Intronic
1173905208 20:46622892-46622914 CTTTTTCTGATAGTTGAGAAAGG - Intronic
1176788345 21:13287206-13287228 CTCTGTCAGATAGTTATGTGGGG + Intergenic
1178241603 21:30908632-30908654 TTCTTACTGATATTTCTGTCTGG + Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
952477943 3:33730808-33730830 CTCTTTTTGATGGTTTTCTCCGG + Intergenic
954068175 3:48123603-48123625 CTCTGTATGCTAGTTGTGTGAGG + Intergenic
954665410 3:52248773-52248795 CTCTTGCTGGTAGCTGTGGCTGG + Intronic
954914793 3:54139528-54139550 CTCATTCTTAGAGTTGTGTATGG + Intronic
957761595 3:84565593-84565615 CTCTTTCTGAGAACTGTGGCAGG + Intergenic
962514285 3:136135513-136135535 CCCTTTCTGATACCTGAGTCTGG - Intronic
964915203 3:161832504-161832526 CTATTTATGATACTTGTGTGTGG - Intergenic
970163633 4:13214153-13214175 GTATTTCTGATAGTGTTGTCAGG - Intergenic
970355944 4:15252084-15252106 CTCTTTCTGAAAGTTGTTTTTGG + Intergenic
970909502 4:21257878-21257900 CTCTTTCTTATGGCTATGTCTGG - Intronic
972011180 4:34184118-34184140 CTCATTCTGATGCTGGTGTCAGG + Intergenic
974088081 4:57282335-57282357 CTCTCTCTTAGATTTGTGTCTGG - Intergenic
979108120 4:116713967-116713989 CTCTTTCTGTGAGTAGTGCCAGG + Intergenic
979132353 4:117063224-117063246 AGCTTTCTGATAATTGTGTGGGG + Intergenic
979294024 4:119010410-119010432 CTGTATCTGATGGTTTTGTCAGG - Intronic
979650795 4:123128406-123128428 CTTTTTCTGATACTTGAGTCAGG + Intronic
980187512 4:129480660-129480682 CTATTTCTCATAGGTGTGCCCGG + Intergenic
980979589 4:139642847-139642869 TTCTTGCTGATAGTTGTTTTTGG + Intergenic
982303794 4:153907369-153907391 AGCTTTCTCATAGCTGTGTCTGG - Intergenic
986354471 5:6910128-6910150 GTCTTTCTGAGAGTTGAGCCGGG - Intergenic
987748505 5:22008645-22008667 CTGTTTGTGATAGTTTTGTTGGG + Intronic
991768681 5:70018443-70018465 CTGTTTGTGATAGTTTTGTTGGG + Intergenic
991847919 5:70893520-70893542 CTGTTTGTGATAGTTTTGTTGGG + Intergenic
991920198 5:71649075-71649097 CTCTTTCTGATCTTTCTCTCAGG + Exonic
993172193 5:84432720-84432742 TTCTTTCTGGTGGTTGTATCCGG + Intergenic
993652747 5:90541985-90542007 CACTTACTGATTATTGTGTCAGG + Intronic
994254104 5:97572190-97572212 GTCTTTCTGCTTGCTGTGTCTGG + Intergenic
1000866297 5:166518842-166518864 CTCTCTCTGCTGGCTGTGTCTGG + Intergenic
1000945241 5:167414600-167414622 CTCTATCTGATTGTTGTGTCTGG + Intronic
1001406623 5:171481571-171481593 CTCATTCTGCTAGTTGGGTGAGG + Intergenic
1002997088 6:2296951-2296973 CTCTATCTGAAAGTTTTTTCAGG + Intergenic
1006714631 6:36108710-36108732 TTCTTTCTGAGAGTTGGCTCAGG + Exonic
1006991051 6:38215108-38215130 CTCTTTCTGATTCTATTGTCAGG + Intronic
1008288330 6:49682007-49682029 CTCCTTCAGATAATTGTGCCAGG + Intergenic
1010084123 6:71896382-71896404 CCCTTTCTAATGCTTGTGTCTGG - Intronic
1010519154 6:76811118-76811140 CATTTTCTGATAGTTCTTTCAGG + Intergenic
1010904056 6:81464345-81464367 GCCTTTCTAATATTTGTGTCAGG + Intergenic
1012855762 6:104499328-104499350 CTCATTCTGTTATTTGTTTCAGG - Intergenic
1014644975 6:123961701-123961723 CTCTTTTTGATAATAGTGTAGGG + Intronic
1017288232 6:152703038-152703060 CTTTCTCTGATAGCTTTGTCAGG + Intronic
1018105129 6:160478573-160478595 CTGTTTCTGAGCATTGTGTCAGG + Intergenic
1018301069 6:162403611-162403633 CTATTTCTGACACCTGTGTCAGG - Intronic
1019703000 7:2483235-2483257 CCCTTTCTGATTGGTCTGTCTGG - Intergenic
1020946991 7:14623947-14623969 CTATTTCTCAGAGTTGTGTAAGG + Intronic
1021887300 7:25152148-25152170 CTCTTTCTGATCTTTTTTTCTGG + Intronic
1023078182 7:36503616-36503638 ATCTTTCTGATTGGTGAGTCTGG + Intergenic
1023108851 7:36789891-36789913 CTCTTTCTGCTTGTTGTGATGGG + Intergenic
1023155846 7:37251215-37251237 ATCTTTTTGATATTTGTTTCTGG + Intronic
1023377257 7:39569589-39569611 CTCTGTATGATATTTGTGGCAGG - Intronic
1024589581 7:50869603-50869625 CTCTCTCTGATAATTCTGTTGGG + Intergenic
1027392487 7:77718972-77718994 CTCTTTCTCCAAGTTGTTTCAGG + Intronic
1028061576 7:86324570-86324592 CTCTTTCAGGCAGTTGTGACTGG - Intergenic
1028471233 7:91208663-91208685 CTTTTTCTGAGAGTTGGGTGAGG + Exonic
1030398434 7:109017730-109017752 CTCTTTGTGGCAGTTGTGGCTGG + Intergenic
1030415026 7:109232081-109232103 TTCTTTTTAATAGTTTTGTCTGG + Intergenic
1032377998 7:131443468-131443490 CTTGTTCTGATAGATGTGTATGG + Exonic
1034269530 7:149796919-149796941 GCCTTTCTCATAGTTGAGTCAGG + Intergenic
1044274685 8:90285866-90285888 CTCTCTCTGCTAGTGGTGCCTGG + Intergenic
1049919924 9:353646-353668 CTCCATCTGACAGTTCTGTCTGG + Intronic
1052015554 9:23461086-23461108 CTATGTCTGTTAGTTGTATCTGG - Intergenic
1052565137 9:30140295-30140317 CTGTATCTGATGGTTTTGTCTGG - Intergenic
1052600006 9:30615326-30615348 CTCTTTCTAATAATTGGTTCAGG - Intergenic
1055827369 9:80343521-80343543 CTTTTTCTGATGTCTGTGTCTGG - Intergenic
1058070678 9:100598165-100598187 CAGTTTCAGATAGATGTGTCAGG + Intergenic
1058547517 9:106076793-106076815 CTCTTTCTTATAGTTTTATAAGG + Intergenic
1185953689 X:4465050-4465072 TTCTTTCTGACAGTTTTGACAGG - Intergenic
1190432727 X:50393335-50393357 CTTTTTCTTTTCGTTGTGTCAGG - Exonic
1192073941 X:67971197-67971219 TTCTTTCTGATATTTTAGTCAGG - Intergenic
1194881377 X:99255688-99255710 CTTTTTCTGATTTTTGTATCAGG + Intergenic
1196536685 X:116853658-116853680 CTCTTTCAGGTATTGGTGTCAGG + Intergenic
1198299259 X:135318391-135318413 CTCTTTAACCTAGTTGTGTCAGG - Intronic
1198734928 X:139775101-139775123 CTCATTCTGAGTGTTGTCTCGGG + Intronic
1201407723 Y:13665220-13665242 ATCTTTCTGATTGGTGAGTCTGG + Intergenic
1201637891 Y:16145737-16145759 CTCTCTCTGATGGCTGGGTCTGG - Intergenic