ID: 1093369884

View in Genome Browser
Species Human (GRCh38)
Location 12:18354228-18354250
Sequence CCTCAAGTCCTGTAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093369879_1093369884 -3 Left 1093369879 12:18354208-18354230 CCAAGATCTCCCTTAATTTGCCT 0: 1
1: 11
2: 38
3: 54
4: 263
Right 1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG 0: 1
1: 0
2: 0
3: 29
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093369884 Original CRISPR CCTCAAGTCCTGTAGGTAGA AGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
902436065 1:16398714-16398736 GCTCAAGGCCTGTAGACAGATGG - Exonic
904926743 1:34055382-34055404 CATCAGGTCCCGTAGGTTGAGGG + Intronic
909293156 1:73910635-73910657 CCTCAAATGCTGTAGCTAGTTGG + Intergenic
910629263 1:89339473-89339495 CCTTAAGTCCTGTAGAGACAAGG - Intergenic
912078965 1:105911927-105911949 CCTTAAGTCCTGTAGAGAGAAGG - Intergenic
912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG + Exonic
914977495 1:152379736-152379758 CTTTAAGTCCTGTAGGGAGAAGG + Intergenic
918132316 1:181640260-181640282 CCTGAAGGCCTGAAGGTACATGG - Intronic
918229415 1:182514601-182514623 CTTCAAGTCCTGTAGAGAGAAGG + Intronic
919955737 1:202413387-202413409 ACTTAAGTCCTGTAGTTACAAGG + Intronic
1063384809 10:5609493-5609515 CCTTAAGTCCTGGAGGTAGTGGG - Intergenic
1063837774 10:10035251-10035273 CATAAAGGCCTGGAGGTAGAAGG + Intergenic
1063977436 10:11428649-11428671 CCTCAGGATCTGTAGGTAGCAGG + Intergenic
1066395478 10:35017081-35017103 CCTCAAGTGCTGTCGATAGCTGG + Intronic
1068062591 10:52087344-52087366 CCAAAAGTCCTGTAGGGAAATGG - Intronic
1070138172 10:73714058-73714080 CCTAAAGTGCTGTATGTAAAGGG + Intergenic
1070138768 10:73720341-73720363 CCTCTTGTCTTGTAGCTAGAGGG - Intergenic
1070855896 10:79607904-79607926 CTTTAAGTCCTGTAGGGAGGAGG + Intergenic
1071201058 10:83221134-83221156 CTTTAAGTCCTATAGATAGAAGG + Intergenic
1071995836 10:91148399-91148421 CCTCAAGTCCTTTACAGAGAAGG + Intergenic
1072258212 10:93641266-93641288 CCTGAAGGCCTATAGGAAGAAGG - Intronic
1073729222 10:106270177-106270199 CCTTAAGTCCTGTAGAGAGAAGG - Intergenic
1078131910 11:8620377-8620399 CCTCAGACCCTGTAGGCAGAAGG + Intronic
1081330325 11:41792906-41792928 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1085312311 11:75524050-75524072 CCCCAAGGCATGTAGGGAGAGGG - Intronic
1085466740 11:76729142-76729164 CCTCATGTCCTGTAGGTGCAGGG - Intergenic
1086266378 11:85003679-85003701 CTTCTAGTCCTATAGATAGATGG + Intronic
1086782863 11:90929412-90929434 CCTTAAGTCCTGTAGAGGGAAGG - Intergenic
1087461647 11:98454979-98455001 CTTTAAATCCTGTAGGGAGAAGG + Intergenic
1088229934 11:107663249-107663271 CCTCAAGGCCAGTAGGGTGATGG + Intronic
1089122391 11:116146426-116146448 CTTTAAGTCCTATAGGGAGAAGG - Intergenic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1090439403 11:126713468-126713490 CCTCAAGGTATGTAGGAAGATGG + Intronic
1092569801 12:9709441-9709463 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1093213538 12:16335668-16335690 CCTAAAGTACTGTTGGTAAAGGG + Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1097130536 12:56807990-56808012 CCTTAAGTCCTGTAGAGAAAAGG + Intergenic
1097140933 12:56902069-56902091 CCTTAAGTCCTGTAGAGAAAAGG - Intergenic
1097289217 12:57899837-57899859 CCTGGTGTCCTCTAGGTAGAAGG - Intergenic
1097747390 12:63316129-63316151 CCTTAATTCCTGTAGAGAGAAGG + Intergenic
1097951991 12:65441225-65441247 CATCAAGACCTGTAGGTACAAGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101133508 12:101713905-101713927 CTTTAAGTCATCTAGGTAGAGGG - Intronic
1101216929 12:102594773-102594795 CCTTAAGTCCTGCAGAGAGAAGG + Intergenic
1101455538 12:104826689-104826711 CTTTAAGTTCTGTAGGGAGAAGG - Intronic
1101815420 12:108142396-108142418 CCTCAGCTCCTGGAGGCAGAGGG + Intronic
1102160104 12:110761929-110761951 CCTCAAGTCCAGTCGTTAGAAGG + Intergenic
1102709627 12:114914743-114914765 CCTCAAGCCCTGCAGATACAAGG - Intergenic
1105241754 13:18614851-18614873 CCCCAAGTCCTGGATGGAGAGGG - Intergenic
1105241832 13:18615148-18615170 CCCCAAGTCCTGGATGGAGAAGG - Intergenic
1107801349 13:44110522-44110544 CCACAAGTCCTGTTGGCAAATGG + Intergenic
1109151841 13:58857447-58857469 CTTTAAGTCCTGTAGAGAGAAGG + Intergenic
1109378117 13:61524382-61524404 CTTTAAGTCCTGTAGAGAGAAGG + Intergenic
1109986542 13:69993646-69993668 CCTCTAGGCCTGAAGGGAGAAGG - Intronic
1110795446 13:79631770-79631792 TCTCAAGGCCTCCAGGTAGATGG + Intergenic
1113142576 13:107170778-107170800 CATAAAGCCCTGTAGGAAGAAGG + Exonic
1117897423 14:60502175-60502197 ACTCAATTTCTGAAGGTAGATGG - Intronic
1120745118 14:88145426-88145448 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1122642189 14:103166358-103166380 CTTTAAGTCCTGTAGAGAGAAGG - Intergenic
1123489561 15:20770157-20770179 CCCCAAGTCCTGGATGGAGAAGG + Intergenic
1123489594 15:20770294-20770316 CCCCAAGTCCTATATGGAGAAGG + Intergenic
1123489609 15:20770349-20770371 CCCCAAGTCCTATATGGAGAAGG + Intergenic
1123489625 15:20770405-20770427 CCCCAAGTCCTATATGGAGAAGG + Intergenic
1123546060 15:21339244-21339266 CCCCAAGTCCTGGATGGAGAAGG + Intergenic
1123546093 15:21339381-21339403 CCCCAAGTCCTATATGGAGAAGG + Intergenic
1123546108 15:21339436-21339458 CCCCAAGTCCTATATGGAGAAGG + Intergenic
1123546124 15:21339492-21339514 CCCCAAGTCCTATATGGAGAAGG + Intergenic
1123677372 15:22724092-22724114 CCTGAAGAGCTGTACGTAGATGG + Intergenic
1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG + Intergenic
1202954403 15_KI270727v1_random:66516-66538 CCCCAAGTCCTGGATGGAGAAGG + Intergenic
1202954436 15_KI270727v1_random:66653-66675 CCCCAAGTCCTATATGGAGAAGG + Intergenic
1202954451 15_KI270727v1_random:66708-66730 CCCCAAGTCCTATATGGAGAAGG + Intergenic
1134848558 16:17461494-17461516 CCTCCACTCCTGCAGTTAGAAGG - Intronic
1136044145 16:27602194-27602216 CCACAGGGCCTGCAGGTAGAAGG - Intronic
1136228840 16:28875561-28875583 CCTTGTGTCCTGTAGGGAGATGG + Intergenic
1141295278 16:82762413-82762435 TCTCAAGTGCTGTAGCTAAAGGG + Intronic
1142827885 17:2525575-2525597 CCCCAAGCCCTGCAGGGAGAGGG - Intergenic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1143391125 17:6559856-6559878 GCTCAAGTCCTGGAGGGAGGTGG - Intergenic
1143666531 17:8365282-8365304 CATCAACTCCTGTGGGTAAAAGG - Intergenic
1146886258 17:36473028-36473050 CTTTAAGTCCTGTAGAGAGAAGG + Intergenic
1146906571 17:36621860-36621882 GCCCAAGCCCTGTAGGAAGACGG - Intergenic
1152013613 17:77735603-77735625 CCTCCAGTCCTGCAGGTGGTCGG + Intergenic
1154447120 18:14444730-14444752 CCCCAAGTCCTGGATGGAGAAGG + Intergenic
1155839797 18:30630944-30630966 CCTTAAGTCCTGGAGAGAGAAGG + Intergenic
1156509289 18:37622262-37622284 CCTAAATTCCTGTGGATAGAAGG - Intergenic
1156592637 18:38508999-38509021 CATCAAGTCCTGTAGGATTAGGG + Intergenic
1157033580 18:43943722-43943744 ACTTAAGTCCTGTCTGTAGAAGG + Intergenic
1157782884 18:50455943-50455965 CCTCAAGTATTGGAGGGAGATGG + Intergenic
1161063641 19:2227279-2227301 ACTCCAGTCCTGTGGGGAGAGGG + Intronic
1161910221 19:7187945-7187967 CCCCAAGGCCTGTAGGGAGTTGG - Intronic
1162660908 19:12168505-12168527 ACTCAAGTCCTGTAGGGAAGGGG + Intronic
1163007172 19:14404369-14404391 CATCACGTCCTGTGGGCAGATGG - Exonic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1167265581 19:48481399-48481421 CCTCAGGTCCTGGGGGAAGATGG - Intronic
925019912 2:560310-560332 CCTCAAGTCCTAGATGGAGAAGG - Intergenic
925019927 2:560393-560415 CCTCAGGTCCTGAATGGAGAAGG - Intergenic
925025247 2:602101-602123 CCTCAAGCCCTGGAGGAAGAAGG - Intergenic
925295858 2:2776704-2776726 TCCCAAGTCCTTTAGGTACAAGG - Intergenic
927698792 2:25254392-25254414 ACCCAAGTCTTCTAGGTAGAAGG - Intronic
930265418 2:49194001-49194023 CCTCAAGTCCTGTATTTTAATGG - Intergenic
930734164 2:54758201-54758223 TTTCAAGTCCTGAAGGGAGAGGG + Intronic
933141102 2:78793735-78793757 CTTTAAGTCCTGTAGGGAGAAGG + Intergenic
935861834 2:107339578-107339600 CCTGATGTCCTGTAAGAAGAAGG + Intergenic
937124857 2:119467608-119467630 AATCAATTCCTGAAGGTAGAAGG - Intronic
938482856 2:131675725-131675747 CCCCAAGTCCTGAATGGAGAAGG - Intergenic
940409933 2:153349818-153349840 CCTCTAGTGCTGAAGGGAGATGG - Intergenic
941186421 2:162325881-162325903 CGTTAAGTCCTGTAGGGAGACGG + Intronic
942419401 2:175792679-175792701 GCTCAAGTCTCTTAGGTAGATGG - Intergenic
945408468 2:209480775-209480797 CCAGAAGTCCTGTTGGTATAGGG + Intronic
946937105 2:224733787-224733809 CATCAGGTCCTATAGGTTGAGGG + Intergenic
948086969 2:235258751-235258773 CCTCAGGCCCTGTTGGTAGCAGG - Intergenic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1171040441 20:21757714-21757736 TCTCAAGTGCTTTAGGTAAATGG + Intergenic
1171393883 20:24818476-24818498 CCTCAAGTCATGGAGGCACAGGG + Intergenic
1173012889 20:39198475-39198497 CCTCAAGTCATTTATGGAGATGG + Intergenic
1176096412 20:63346459-63346481 GCCCGAGTCCTGCAGGTAGAAGG + Exonic
1176257515 20:64159934-64159956 CCTCAGGCCCTGCAGGCAGAGGG - Intronic
1179917816 21:44489071-44489093 CTTTAAGTCCTGTAAGGAGAAGG - Intergenic
1184071562 22:42150498-42150520 CCCCAATACCTGTAGGGAGAGGG - Intergenic
951586060 3:24215860-24215882 TCTGAAGTCCTAGAGGTAGATGG + Intronic
951878572 3:27457115-27457137 TCCCAAGTCCAGTAGTTAGAGGG - Intronic
952586623 3:34900504-34900526 TCTGAAGTCCTCCAGGTAGATGG - Intergenic
953454294 3:43029683-43029705 CCTCATGTCCAGGAGGCAGAAGG + Intronic
956557765 3:70541309-70541331 CCTGAAGTCCTGTAGAGAGAAGG + Intergenic
958466959 3:94471251-94471273 CCTTAAGTCTTGTAGAGAGAAGG + Intergenic
959479200 3:106850724-106850746 ACTCAAGTCCTTTTGGGAGAGGG - Intergenic
959902959 3:111680385-111680407 CCTCAAATCCTGTAGGAAAATGG - Intronic
960062452 3:113338728-113338750 CTGTAAGTCCTGTAGGGAGAAGG + Intronic
963643008 3:147881390-147881412 CCTTAAGTCCTGTAGAGAAAAGG + Intergenic
965768441 3:172155515-172155537 CCTCAAGTCTAGTAGGTAGGTGG + Intronic
967801121 3:193661227-193661249 CCTGAAATCCTGTGGGGAGAAGG - Intronic
968747147 4:2365904-2365926 CCACCCCTCCTGTAGGTAGAGGG - Intronic
971150439 4:24025700-24025722 CCTCAAGTGCAATAGATAGAGGG + Intergenic
972918216 4:43905608-43905630 CTTTAAGTCCTGTAGGGAGGAGG - Intergenic
974697582 4:65396277-65396299 CCTTAAGTCCTGTAGAGAAAAGG - Intronic
974994611 4:69139432-69139454 ACTCAAGGACTGTAGATAGAGGG - Intronic
975713850 4:77187103-77187125 CCTCTAGGCCTGAAGGTACAAGG - Intronic
976444593 4:85116213-85116235 CCTCAAGGCCTGGAGGTGAATGG + Intergenic
981236232 4:142419001-142419023 CATCAAGTCCTGTAAGTTGTAGG - Intronic
988007179 5:25431365-25431387 GCTCAAGTCCTTTAGGTAAACGG + Intergenic
988196684 5:28013730-28013752 CCTAAAGTCCTGTAATGAGAAGG - Intergenic
988482946 5:31644894-31644916 CATCAAGCCCTCTAGGTAGGAGG + Intronic
988604371 5:32667339-32667361 CCTTAAGTCTTGTAGAGAGAAGG + Intergenic
988923039 5:35962303-35962325 CTTTAAGTCCTGTAGGGGGAAGG + Intronic
990790653 5:59475039-59475061 CTTCAAGTCATGAAGGAAGAAGG + Intronic
994774555 5:104026182-104026204 CCTTAAGTCCTGTAGAGAGAAGG - Intergenic
995389417 5:111623937-111623959 CCTAAAGTCCTGCAGCCAGAAGG - Intergenic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1000003985 5:157166244-157166266 GCAGAAGTCCTGTAGGGAGATGG - Exonic
1000939054 5:167338219-167338241 CCTTTAGTCCTGTGGGTAGAGGG - Intronic
1004406604 6:15338819-15338841 CTTTAAGTCCTGTAGGGAGAAGG - Intronic
1005466942 6:26124712-26124734 CCTCACTGCTTGTAGGTAGAAGG + Exonic
1006068310 6:31478336-31478358 CCTCAACTCCTGTTGGTATCAGG + Intergenic
1006208682 6:32374373-32374395 CTTTAAATCCTGTAGGAAGAAGG - Intergenic
1006987545 6:38186139-38186161 CCTCCAGTGCTGTGGGCAGATGG - Intronic
1007129101 6:39452929-39452951 CCTCAATTCCAGTAGGTCCAAGG - Intronic
1007882422 6:45182374-45182396 CCTCAAGCCCTCCAGGTAGCTGG + Intronic
1009626635 6:66144598-66144620 CTTTAAGTCCTGTAGAGAGAAGG + Intergenic
1011899551 6:92275264-92275286 CCTCAGGTTCTGTGGGCAGAGGG - Intergenic
1014277066 6:119399400-119399422 CCTTAAGTCCTGTAGAGAGAAGG + Intergenic
1015347327 6:132175151-132175173 CCTCCAGGCCTGTAAGGAGAGGG + Intergenic
1019042735 6:169119935-169119957 CCTTCAGTCCTGTAGAGAGAGGG - Intergenic
1019892865 7:3960537-3960559 CTTCCAGTCCTGGTGGTAGAGGG + Intronic
1020606192 7:10339949-10339971 CCCTAAGTGCTTTAGGTAGAAGG + Intergenic
1021115211 7:16739396-16739418 CCTCACGTCCCATAGGTTGAGGG - Intergenic
1024264905 7:47598927-47598949 CTTTAAGTCCCGTAGGGAGAAGG - Intergenic
1030386908 7:108876412-108876434 CTTTAAGTCCTGTAGAGAGAAGG - Intergenic
1032917814 7:136511528-136511550 CCTTAAGTCCTGTAGAGAGAAGG + Intergenic
1033146266 7:138872819-138872841 CCTTAAGCCCAGGAGGTAGAGGG + Intronic
1036452598 8:8881886-8881908 CCTCAAGGCCAGGTGGTAGAAGG + Intronic
1037464372 8:19145020-19145042 CATCTAGTACTGTAGTTAGAAGG - Intergenic
1042237509 8:66627713-66627735 CCTGAAGTCCTGGAGTTAGGTGG - Intergenic
1043558040 8:81457091-81457113 ACTCAAGTCCTTTAGGAAGGTGG + Intergenic
1046138711 8:110062513-110062535 CTTTAAGTCCTGTAGGGAGAAGG - Intergenic
1048106858 8:131420373-131420395 CCTCAAGTCCTATAAGCACAAGG + Intergenic
1051192968 9:14534240-14534262 CCTCAGGTGCTCTAGGTGGAAGG + Intergenic
1056301896 9:85250292-85250314 CCTGAAGCCCTGTGAGTAGAGGG - Intergenic
1056692355 9:88818720-88818742 GCTGCAGTTCTGTAGGTAGATGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1062261489 9:135665299-135665321 CCTGAAGTTCTGGAGGTGGAAGG - Exonic
1189414681 X:40803641-40803663 CTTTAAGTCCTGTAGAGAGAAGG + Intergenic
1193321129 X:80122729-80122751 CATGAAATCCTGTTGGTAGAAGG - Intergenic
1194124076 X:89992279-89992301 CCTTAAGTCCTGTAGAGAAAAGG + Intergenic
1195722028 X:107876841-107876863 CCTTAAGTCCTGTAGAGAGAAGG + Intronic
1195853684 X:109308840-109308862 CCTTAAGTCCTGTAGAGAGAAGG + Intergenic
1197397862 X:125949519-125949541 CCTCAAGTGCTGAATGTAGCTGG + Intergenic
1197610446 X:128632474-128632496 CCTCAAGTGCTTTAGATGGAAGG - Intergenic
1199434961 X:147802785-147802807 GCTCAAGTCCTGGAGTTGGAAGG - Intergenic
1200476963 Y:3649901-3649923 CCTTAAGTCCTGTAGAGAAAAGG + Intergenic
1201921056 Y:19233481-19233503 CTTCAAGTACTATAGGGAGAAGG - Intergenic
1202578871 Y:26357794-26357816 ACTTAAGTCCTGTAGTTACAAGG - Intergenic