ID: 1093371087

View in Genome Browser
Species Human (GRCh38)
Location 12:18365903-18365925
Sequence TAGGGTCTGAAACGAGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093371087_1093371090 -3 Left 1093371087 12:18365903-18365925 CCTGAATCTCGTTTCAGACCCTA 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1093371090 12:18365923-18365945 CTATGTTCAGAAAATCTTAATGG 0: 1
1: 0
2: 1
3: 17
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093371087 Original CRISPR TAGGGTCTGAAACGAGATTC AGG (reversed) Intronic
900996858 1:6127591-6127613 TAGGGACTGAAACCAGACCCCGG + Intronic
904597961 1:31658558-31658580 TAGGGTCTGAAAGGAGACCGAGG - Exonic
912570888 1:110620183-110620205 GAGGGTCTGAAAGGAGAGGCCGG - Intronic
919760055 1:201092095-201092117 TAGGGTCTTCACCGTGATTCTGG - Exonic
922020988 1:221704778-221704800 TTGAGTCTGAAAGGAAATTCAGG - Intronic
924817269 1:247453623-247453645 TAGGCTCTGAAAAGAAACTCTGG - Intergenic
1071569508 10:86689155-86689177 TAGGGTCAGAAACGAGTTATGGG - Intronic
1072352561 10:94571767-94571789 TAAGGTCTGAAGCAAGATTAAGG - Intronic
1077622110 11:3735205-3735227 TAGGGTCTGACATCGGATTCCGG + Exonic
1079553540 11:21731242-21731264 GAGGGGATGAAATGAGATTCAGG + Intergenic
1080299846 11:30771800-30771822 GAGGGGTTGAAATGAGATTCAGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1093371087 12:18365903-18365925 TAGGGTCTGAAACGAGATTCAGG - Intronic
1093530421 12:20155378-20155400 TAGGGTCTTCAAGGAGACTCAGG - Intergenic
1096229726 12:49890149-49890171 CAGGGTCTGAAAGGAGAAGCAGG + Exonic
1096423583 12:51481639-51481661 TAGGTTATGAAACAAGGTTCTGG + Intronic
1096530715 12:52241250-52241272 CAGTGTCTCAAACGAGAATCTGG - Intronic
1096943612 12:55377910-55377932 AAAGATCTGAAAAGAGATTCTGG - Intergenic
1108363086 13:49685526-49685548 TAGGCTTTGGGACGAGATTCTGG - Intronic
1131611581 15:93969982-93970004 TAGGGACAGAGACGAGATTAGGG + Intergenic
1156261493 18:35448524-35448546 TAGGGCCTGAAAAAAGGTTCAGG + Intronic
1165661616 19:37585716-37585738 TAGGTTTTGTAACGAAATTCAGG - Intronic
1167683904 19:50943558-50943580 GAGGGTCTGAAAGGAGTGTCAGG + Exonic
925584284 2:5447601-5447623 TAGAGTCTGTAACGAGATTTGGG - Intergenic
927614192 2:24573845-24573867 TAGCACCTGAAATGAGATTCAGG + Intronic
930284667 2:49412996-49413018 TAGGGCCTGAGAAGAGACTCGGG - Intergenic
930956216 2:57205952-57205974 TAGGTTCTGTAACAAGATTTTGG + Intergenic
933360786 2:81281486-81281508 TAGTGACTGAAACTACATTCCGG + Intergenic
939528992 2:143333753-143333775 TAGGCACAGAAACAAGATTCGGG + Intronic
946009297 2:216552193-216552215 TAGGGTATGAAAAAAGATTCGGG - Intronic
1174819654 20:53715477-53715499 TATGGTGTGAAACAAAATTCAGG + Intergenic
1181041547 22:20194892-20194914 TGGGGTCTGCAAGGAGATACCGG - Intergenic
1185253041 22:49815716-49815738 CAGTGTCTGAAACGGCATTCAGG + Intronic
952898171 3:38093025-38093047 ATGGGCCTGAAACGAGACTCTGG - Intronic
954134776 3:48576900-48576922 TAGGGAGAGAAAGGAGATTCAGG - Exonic
962338765 3:134563220-134563242 TTGGGTCTGAGATAAGATTCTGG - Exonic
973009743 4:45057884-45057906 TTGGGTCTGAAACAACTTTCTGG + Intergenic
980022957 4:127730919-127730941 TAGGTTCAGAAACTAAATTCTGG - Intronic
985285253 4:188330556-188330578 CAGGGTCGGAACCGAGAGTCAGG + Intergenic
986126009 5:4882848-4882870 AAGTGTCTGAATCCAGATTCTGG + Intergenic
986790725 5:11157040-11157062 GATGGTCTGAAACCAGAGTCAGG + Intronic
988161721 5:27526159-27526181 TAGGGTTAGAAAAGAGATTAAGG + Intergenic
991372077 5:65929483-65929505 TAGGGTATGTAAGGAGAATCTGG - Intronic
999315774 5:150582869-150582891 GAGGGTCTGAAAGCAGATTCTGG + Intergenic
1002444373 5:179280141-179280163 TAGGGCCTGAAACCAGGTCCAGG - Intronic
1008981723 6:57491233-57491255 TAGGGGCTGAAAAGATAATCTGG - Intronic
1009169798 6:60384056-60384078 TAGGGGCTGAAAAGATAATCTGG - Intergenic
1015560467 6:134510098-134510120 TATGTTCTGAAAAGTGATTCAGG + Intergenic
1019865795 7:3708740-3708762 TACAGTTTGAAACGAGATTTGGG + Intronic
1030103103 7:105963251-105963273 TTGGGTGTGAGACGGGATTCAGG + Exonic
1030556760 7:111034842-111034864 TAGGTGCTGGAACGAGTTTCTGG - Intronic
1032398457 7:131607499-131607521 TAGGGACTGAATAGAGAGTCAGG - Intergenic
1037104516 8:15090342-15090364 TAGGCTCAGAAACCATATTCAGG - Intronic
1050376157 9:4975489-4975511 TTGGGTTTGAAATGAAATTCAGG + Intergenic
1050376234 9:4976287-4976309 TTGGGTTTGAAATGAAATTCAGG - Intergenic
1050891897 9:10835209-10835231 CAGGGTCTGAAACATGGTTCAGG - Intergenic
1051668594 9:19488403-19488425 AAGACTCTGAAACCAGATTCTGG - Intergenic
1052642537 9:31188066-31188088 TAGGGTTAGAAATGGGATTCTGG - Intergenic
1054946444 9:70801194-70801216 TAGGGTCTCAAACTGGTTTCTGG + Intronic
1055801493 9:80041403-80041425 TAGTGTCTCAAACTAGATTCTGG - Intergenic
1056046476 9:82722794-82722816 CAGGCTATGAAACAAGATTCTGG + Intergenic
1058772115 9:108245539-108245561 AAGGGTCTGAAGCCAGATGCAGG + Intergenic
1061933183 9:133843813-133843835 CAGGGTCTGAAACCAAAGTCAGG + Intronic
1186428872 X:9487334-9487356 TAGAGGCAGAAACCAGATTCAGG - Intronic
1190058226 X:47194417-47194439 AAGTGTCTCAAAGGAGATTCTGG - Intronic
1190290435 X:48988829-48988851 TGGGGTCTGAGACGGGAGTCTGG - Intronic
1193790032 X:85806608-85806630 TTGGGCCTGATATGAGATTCTGG + Intergenic
1197852388 X:130876813-130876835 TAGAGGCTGAAAAGAGATTTTGG + Intronic