ID: 1093371395

View in Genome Browser
Species Human (GRCh38)
Location 12:18370152-18370174
Sequence TGGCATCCCTAATAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093371395 Original CRISPR TGGCATCCCTAATAGGGGCA GGG (reversed) Intronic
901174999 1:7292699-7292721 TGGCATCCCTCATAGGAACTGGG - Intronic
902035648 1:13456165-13456187 AGGCTTCCCTGATAGGGGGAGGG + Intergenic
909051377 1:70772628-70772650 TGGCATCCCTGAAAGGGACAGGG - Intergenic
910812799 1:91254995-91255017 TGGCATCCCTCAAAGGGACAGGG + Intergenic
915845036 1:159253831-159253853 TGGCATCCCTGAAAGGGACGGGG + Intergenic
919981683 1:202645890-202645912 TGTCATCCCTATCAGGGGAAGGG - Intronic
923406017 1:233661371-233661393 TGGCATTCCTAGTTGGGACATGG - Intronic
923684332 1:236143225-236143247 TGCCATTCCCAAAAGGGGCAAGG + Intronic
1062833924 10:623832-623854 TGGCAGCATTCATAGGGGCATGG - Intronic
1065706672 10:28477105-28477127 TGGCATCTCCAAAATGGGCAAGG + Intergenic
1066171718 10:32855744-32855766 TCGGGTCCCTTATAGGGGCAGGG - Intronic
1068892933 10:62166690-62166712 TGGCATCCCTCTTTGGAGCAGGG - Intergenic
1071394521 10:85208159-85208181 TGGCAACCCTACTAGGTGCCAGG - Intergenic
1074360611 10:112821887-112821909 TGGCATCCCTCAAAGGGTCAAGG - Intergenic
1076393669 10:130122331-130122353 TGGCTTCCCTTATAGGGAGAAGG - Intergenic
1076438432 10:130462608-130462630 TGAAATCCCTAATGGGGGCTAGG - Intergenic
1079308304 11:19344003-19344025 CTGCATCCCAAATAGGGGCCCGG + Intergenic
1085932856 11:81106177-81106199 TTGCATGCCTCATAAGGGCAGGG - Intergenic
1087828164 11:102789697-102789719 TGGAATCCATAAATGGGGCAAGG + Intergenic
1089531207 11:119131013-119131035 AGGCATCCCTGAAAGGGACAAGG - Intronic
1091766390 12:3122872-3122894 TGGCAGCCCTCCTAGGGGCAAGG - Intronic
1093371395 12:18370152-18370174 TGGCATCCCTAATAGGGGCAGGG - Intronic
1093528598 12:20134839-20134861 TGGCATCCCTGAAAGGGACAGGG - Intergenic
1094347767 12:29489631-29489653 TGGCTTCCCTGATTGGGGAATGG - Exonic
1098632604 12:72742097-72742119 TGGCATCCCTAAAAGAGAAAAGG + Intergenic
1102343890 12:112145855-112145877 TGGCATCCTTTGTAGGGACATGG + Intronic
1105273110 13:18895698-18895720 TGGCAGCCCTAACACAGGCAGGG - Intergenic
1106685708 13:32056535-32056557 TGGAAACCATAATAAGGGCAGGG - Intronic
1110046787 13:70841959-70841981 AGGCATGCCCCATAGGGGCAGGG - Intergenic
1113709186 13:112452837-112452859 TGGCAGCCCTCATCCGGGCAAGG - Intergenic
1117452382 14:55864296-55864318 TGGCATCCCTGAAAGAGACAGGG - Intergenic
1121890624 14:97587179-97587201 TGGCTTCCTTGATAGGGGCTGGG - Intergenic
1123933486 15:25183034-25183056 TGGCACCCCTCATATGGCCAGGG - Intergenic
1124070896 15:26392366-26392388 TGCCATCCTTCATAGGGGCATGG + Intergenic
1124497374 15:30194626-30194648 TGTCATCCCTATCAGGGGAAGGG - Intergenic
1124746199 15:32344021-32344043 TGTCATCCCTATCAGGGGAAGGG + Intergenic
1134749387 16:16613785-16613807 TGGCTTCCCTAATCAGGGAAGGG + Intergenic
1134996083 16:18739838-18739860 TGGCTTCCCTAATCAGGGAAGGG - Intergenic
1139544644 16:67644670-67644692 TTGGATCCCTAACAGGGTCACGG + Intergenic
1141191726 16:81829938-81829960 TGGCATCCCCACTAGGTGCCAGG + Intronic
1144880750 17:18429327-18429349 TGGCCTCCCTGATGAGGGCAGGG + Intergenic
1146765397 17:35516246-35516268 TGGGGTCCCTACTAGGGGCATGG + Intronic
1153684814 18:7535345-7535367 TGGCACCCCACATAGGGCCACGG + Intergenic
1157453039 18:47802077-47802099 TGGCTTCTCTAATAAGGGGAAGG + Intergenic
1158863637 18:61616943-61616965 TAGCAGCCCTAATAGAGGGAGGG - Intergenic
1161204517 19:3034105-3034127 TGGGAACCCTGATAGGAGCAGGG - Intronic
1161268261 19:3375174-3375196 AGGCATCCATGATGGGGGCAGGG - Intronic
1162492751 19:11003672-11003694 TGGCATCCCTTATCTGGGAATGG + Intronic
1163488230 19:17602084-17602106 TTGCATCTCTGATGGGGGCATGG + Exonic
1165731878 19:38151174-38151196 TGTCATCCCTCTTAGGAGCAAGG + Intronic
1166911552 19:46162406-46162428 TGGCATCCCTGAAAGGGAGAGGG - Intergenic
925332286 2:3067959-3067981 TGTCATCCCCAGGAGGGGCATGG + Intergenic
931874925 2:66502229-66502251 TGGCTTCCCAAATATAGGCAGGG + Intronic
935490868 2:103718122-103718144 TGGCATCCCTAAAAAGGACAGGG + Intergenic
936055439 2:109258776-109258798 TGTCCTTCCTAATAGGGGTAGGG + Intronic
937091514 2:119209462-119209484 TGGGATCCCGAATAAGGGAAAGG + Intergenic
938148336 2:128858506-128858528 TGGAGTCCCTAATGGGGGTAGGG - Intergenic
938581617 2:132651601-132651623 TCACATCCTTAATAGGGGAAAGG + Intronic
939582064 2:143962124-143962146 TGGCTGCCATAATAGGGCCATGG - Intronic
940674584 2:156713127-156713149 TGGCATCCCTAAAAGGCGAGGGG - Intergenic
1175762935 20:61573474-61573496 TGGCATCCGGAAGTGGGGCATGG + Intronic
1176218637 20:63959705-63959727 TGGCAGCCTTAACAGGGGAAGGG + Exonic
1176809662 21:13525123-13525145 TGGCAGCCCTAACACAGGCAGGG + Intergenic
1177136992 21:17315354-17315376 TGGCATCTCTGAAAGGGACAAGG + Intergenic
1177764510 21:25441543-25441565 TGGCATCCCTAAAAGGGACGAGG + Intergenic
1178736804 21:35159967-35159989 TGACATCCCTAATGGGGGAAAGG + Intronic
1180642400 22:17309845-17309867 TGGCATCAGTAATCGTGGCAGGG + Intergenic
1184268345 22:43362855-43362877 TAAGATCCCTAATAGGGGCTGGG + Intergenic
950505796 3:13393684-13393706 GGGCATCCCTAAGGGTGGCAAGG + Intronic
950952209 3:17012115-17012137 TGGCATCCCGTATAGGGGGCTGG - Exonic
955573007 3:60327933-60327955 TGGCATCCCTCAAAGGGCAAGGG + Intronic
961943591 3:130662163-130662185 TGTCATCCCAAATAGGGCCAAGG - Exonic
964255522 3:154770973-154770995 TGGCATCCCTGAAAGGGGTGAGG - Intergenic
967458914 3:189722501-189722523 TTGAATCCCAAACAGGGGCAGGG + Intronic
969349614 4:6590826-6590848 TGTGATCCCTGATAGGGACAAGG - Intronic
970475228 4:16415455-16415477 TGTCAACCCTGATAGGGGCCTGG + Intergenic
974184472 4:58429048-58429070 TGGCATCCCTGAAAGGGAGAGGG - Intergenic
974777613 4:66506805-66506827 TGGCATCCCAAATAGGATCTTGG + Intergenic
978238201 4:106486165-106486187 TGGCATCCCTGATAGGGAGAGGG - Intergenic
978689136 4:111485217-111485239 TGGTATCCCTAAAAGAGACAGGG + Intergenic
979045170 4:115853352-115853374 TGGCATCCCTGAAAGGGTCGGGG + Intergenic
984067310 4:175063874-175063896 TGGCATCCCTGCAAGGGACAAGG - Intergenic
987465577 5:18268136-18268158 TGGTATCCATCTTAGGGGCATGG - Intergenic
996117184 5:119631899-119631921 CGGCAACCCTAATAAGGGGATGG - Intronic
1003437484 6:6105272-6105294 TGCCATCCCTGAAAGGGACAGGG - Intergenic
1006734532 6:36263690-36263712 TGGCCTCACTGATGGGGGCAAGG + Intronic
1007215892 6:40237110-40237132 TGGCATCCCTGAAAGGGAGAGGG + Intergenic
1007292043 6:40795014-40795036 TGGCATCAATAAGAGGGGCTGGG + Intergenic
1011034134 6:82955161-82955183 TGACATCCTTAAAGGGGGCAAGG + Intronic
1016279447 6:142398462-142398484 TGGTATCACTAATAGAGACAGGG - Intronic
1017727601 6:157286351-157286373 TGGCATCCCCAATAAGGACAAGG - Intergenic
1017994364 6:159519681-159519703 CGGCATCCCTGAAAGGGACAGGG - Intergenic
1018984102 6:168622817-168622839 TGGCATCCATAGAAGGGACAAGG + Intronic
1024165583 7:46726056-46726078 TGGCATCCCTGAAAGGGACAGGG + Intronic
1030374822 7:108743430-108743452 TGGCATCCCTAAAAGGGATAGGG - Intergenic
1032775489 7:135108797-135108819 TTGCATCCCTGAAAGGGACAGGG - Intronic
1034593169 7:152161700-152161722 TGGTATCCCTAAGAGTGCCAAGG + Intronic
1035522457 8:285831-285853 TGGCCCCTCTAATAGGGGCGTGG + Intergenic
1036711171 8:11079570-11079592 TGGCATCAGGAAAAGGGGCAAGG + Intronic
1039571504 8:38590384-38590406 TGGCAGCCCTGGTAGGAGCACGG + Intergenic
1042108494 8:65354694-65354716 TGGCATCCCTGAAAGGGATAGGG - Intergenic
1044172384 8:89071087-89071109 TGGCATTCCTAATAGAGAAAAGG - Intergenic
1044726463 8:95198316-95198338 TGGCATGCTTAATATGGGCGAGG - Intergenic
1047314026 8:123715859-123715881 TGGCCTCCCTAAAACGGGAAGGG - Intronic
1051444554 9:17126560-17126582 TGGCATACCTAATATGTGCTAGG - Intergenic
1052703171 9:31961692-31961714 TGGCATCCCTGAAAGGGGGAGGG + Intergenic
1053034655 9:34814325-34814347 TGGCATCCCTAGTATGGCCCAGG - Intergenic
1056705983 9:88953142-88953164 GGGCATCCCTTAGAGGGGCCAGG - Intergenic
1061516426 9:131092977-131092999 TGGCTCCCCTGACAGGGGCAGGG + Exonic
1192696629 X:73422798-73422820 TGGCATCCCTAAAAGGGAGGGGG + Intergenic
1193299191 X:79868892-79868914 TGGCATCCCTGAAAGGGAGAGGG + Intergenic
1193334802 X:80275257-80275279 TGGCGTACCTAAAAGTGGCATGG + Intergenic
1193805346 X:85987189-85987211 TGGCATCCCTGAAAGAGACAGGG + Intronic
1196637729 X:118022522-118022544 TGGCCAACCTAATAGGTGCAAGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1200803776 Y:7411275-7411297 TGCCATCCCTAATAGAGCCAAGG - Intergenic