ID: 1093375613

View in Genome Browser
Species Human (GRCh38)
Location 12:18423705-18423727
Sequence TTGTATATGGATAAGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093375613_1093375617 10 Left 1093375613 12:18423705-18423727 CCTTATTTCTTATCCATATACAA 0: 1
1: 0
2: 4
3: 35
4: 374
Right 1093375617 12:18423738-18423760 CAAAACTATACAAATCCAAATGG 0: 1
1: 0
2: 2
3: 50
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093375613 Original CRISPR TTGTATATGGATAAGAAATA AGG (reversed) Intronic
902446193 1:16466143-16466165 TTATATATTGATAAGGGATAAGG + Intergenic
902952554 1:19897884-19897906 TTGTATGTGTATAAGATACATGG + Intronic
903908019 1:26699575-26699597 CTGCATCTGGACAAGAAATAGGG + Intronic
905608729 1:39329402-39329424 ATGAATATGGATAAATAATAAGG - Intronic
905968818 1:42124391-42124413 TTGTATATGGTTATGAGGTAGGG - Intergenic
905985977 1:42282650-42282672 TAGTAACTGGATAAGGAATAAGG + Intronic
908017699 1:59861601-59861623 TTTTCTATGGATAAGGAATATGG + Intronic
908198132 1:61766154-61766176 ATATACATGGAAAAGAAATAAGG - Intronic
908377180 1:63555467-63555489 TTGTATATAGAGATGAAACAGGG + Exonic
908974042 1:69876189-69876211 TTTGATATGGACAAAAAATATGG - Intronic
910172318 1:84390732-84390754 TCTTATAGGGAAAAGAAATAAGG + Intergenic
911491296 1:98570322-98570344 TTAAATATGTATTAGAAATAGGG + Intergenic
911517358 1:98882715-98882737 ATGTATTTGTTTAAGAAATAGGG + Intergenic
913432745 1:118813381-118813403 TTGTATCTTGGTAAGCAATAAGG + Intergenic
914698265 1:150106075-150106097 TTGTATATGGTTAAGAGATAGGG - Intronic
919173393 1:193987790-193987812 CTTTATATGCAAAAGAAATATGG + Intergenic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
919681249 1:200436899-200436921 TTGGGTAAGGATTAGAAATACGG + Intergenic
919966155 1:202527476-202527498 TAGTATTTGGAAGAGAAATAGGG + Intronic
922143667 1:222916799-222916821 TTGTGAAAAGATAAGAAATAAGG - Intronic
922375295 1:224957933-224957955 TTGGATATGCAAAAGAAAAAAGG + Intronic
923271964 1:232363717-232363739 TTGTATATTTAGAAGAAATGGGG - Intergenic
923859070 1:237874819-237874841 TTGTAAATGGATAAACAAAATGG + Intergenic
1063794523 10:9497221-9497243 TTGTATATGGCTAAGATTTTGGG - Intergenic
1064325210 10:14343978-14344000 ATGTATATGGAAAAAAGATAGGG - Intronic
1064531302 10:16313083-16313105 CTCTATATGGGTTAGAAATAGGG + Intergenic
1064621624 10:17223355-17223377 TTGTATAAGGATTAGAAAGCAGG - Intergenic
1065048707 10:21768098-21768120 TTGTATATTTTTAAGAAATATGG + Intronic
1065322832 10:24524858-24524880 TTGTGTATGGATCAGAGACAGGG + Intronic
1065426572 10:25611229-25611251 TTGTTTATGGATAATATATTTGG - Intergenic
1065832004 10:29623049-29623071 GTGTATATGTGAAAGAAATAAGG + Intronic
1066486502 10:35850907-35850929 ATAAATATGGATAATAAATATGG + Intergenic
1068812459 10:61271215-61271237 GTGTATATCTATAAGAAATATGG - Intergenic
1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG + Intronic
1070209364 10:74299625-74299647 ATATATATGGATCAGAAAAAAGG + Intronic
1071464859 10:85929817-85929839 TTAAATATGATTAAGAAATATGG - Intronic
1071905589 10:90170098-90170120 TTGGATAAGAATAAGAAATATGG + Intergenic
1073153647 10:101329267-101329289 TTGTCTTTGGATAAGCAAGAGGG + Intergenic
1073694282 10:105847823-105847845 TAGGATATAGATTAGAAATAGGG - Intergenic
1074793948 10:116922191-116922213 TTGTATATGTATTGGAAATTTGG - Intronic
1077381747 11:2246208-2246230 AGATATATGGATAATAAATAAGG + Intergenic
1077789260 11:5420841-5420863 ATATATATGTACAAGAAATAAGG - Intronic
1077892304 11:6428088-6428110 TTGTACATGTAAAAGACATAGGG + Intergenic
1078783724 11:14465627-14465649 TTGTAAATGCTTAAGAAACATGG + Intronic
1079570474 11:21936943-21936965 CTGGATATGGAAAATAAATAAGG - Intergenic
1080033975 11:27692190-27692212 TTGTTTATGGACTATAAATAAGG + Intronic
1080252426 11:30248942-30248964 ATGTATTTGCAAAAGAAATATGG + Intergenic
1080276961 11:30513552-30513574 CTGTAGATGGATAAGACAGAAGG + Intronic
1080502624 11:32885254-32885276 GTTTATATGGGTAAGAGATAGGG - Intergenic
1080768953 11:35322736-35322758 TTGTATTTGGATAAGAATGCTGG + Intronic
1081053997 11:38385454-38385476 TTGTATCTGGAAAAGAACTGAGG + Intergenic
1081220825 11:40459138-40459160 GTGTATATGCATATGAAAGAGGG - Intronic
1081517592 11:43848312-43848334 TTGTAAATGGCCAAGAAAAAAGG - Intronic
1082627745 11:55504124-55504146 TTGTATGTGGATAAACAAAATGG + Intergenic
1083007986 11:59366978-59367000 TTGTATATTAATAAGCAATTTGG - Intergenic
1084620419 11:70266641-70266663 TTGTTTATGTATAAAAATTAAGG + Intergenic
1085432906 11:76471003-76471025 TTGTATATTGATATGAAGAATGG - Intronic
1086595339 11:88564066-88564088 TTTGATATGGATAAGAAAAAGGG - Intronic
1086737972 11:90330165-90330187 ATGTATATGAATAAATAATAAGG - Intergenic
1087790104 11:102396624-102396646 TTTTTTATGCTTAAGAAATATGG + Exonic
1087883238 11:103444982-103445004 TGGTATATGAATAAGCTATAGGG + Intronic
1088412691 11:109552813-109552835 TTGTTAATGGATTAGATATATGG + Intergenic
1088801120 11:113308211-113308233 TTCTAGATGGAAAAGGAATAAGG - Intergenic
1089624795 11:119744490-119744512 TGGTAGATGGGTAATAAATAGGG + Intergenic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1090772951 11:129937965-129937987 TTAAATATAGATAAGAAATCAGG - Intronic
1092865899 12:12760716-12760738 CTATATGTGGATAAGAAAAAAGG + Intronic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1094123308 12:26996857-26996879 CAGGATCTGGATAAGAAATAGGG + Exonic
1094695290 12:32812068-32812090 GTGTATGTGGAAAAGATATATGG + Intronic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1095611329 12:44132077-44132099 TTATTGATGGATAAGAATTAGGG + Intronic
1097781793 12:63715251-63715273 TTGCATATGTACAAGGAATAGGG + Intergenic
1097939696 12:65290619-65290641 TTTTAGAAGGATAACAAATAAGG - Intronic
1098160830 12:67647793-67647815 TTGTATATGGCGAATAAAAAAGG + Intergenic
1098211658 12:68172645-68172667 TTTTATGTAAATAAGAAATATGG + Intergenic
1098581510 12:72104634-72104656 TGGTATATGGATAATGAACAAGG + Intronic
1098657911 12:73056377-73056399 TTTTATGAGGATTAGAAATAAGG - Intergenic
1099313061 12:81051887-81051909 TTGTTTAAGGCTTAGAAATATGG - Intronic
1099353156 12:81598933-81598955 GTATATATGTATATGAAATAAGG - Intronic
1099711316 12:86228627-86228649 TTTTCTATGGAAGAGAAATAAGG + Intronic
1100510977 12:95273033-95273055 TTTTATTTTGATAAGAAATGAGG - Intronic
1100763908 12:97842175-97842197 TTGTTTATAGATAAGACATGTGG + Intergenic
1103115504 12:118326184-118326206 TTGTATATGGTTGAGAGATAAGG + Intronic
1103855567 12:123967392-123967414 TTGCACATTGATAAGAAAGATGG - Intronic
1104119871 12:125789022-125789044 ATGTATATGTATAAGAAAAAGGG + Intergenic
1104235645 12:126933965-126933987 TTGTTTTTGGGTAAGAAATTGGG - Intergenic
1104706161 12:130949039-130949061 TGGTAGGTGGATAAGAAGTAGGG + Intergenic
1105314015 13:19240611-19240633 GTGTAGATGAATAAGAAATATGG + Intergenic
1106166112 13:27248067-27248089 TTGTACATGGATAAAAATGATGG + Intergenic
1106973396 13:35174246-35174268 TTTTAGCTGGATAAAAAATAAGG - Intronic
1107369449 13:39728089-39728111 TTGTCTATAGGTAAGAAATTAGG + Intronic
1107619738 13:42214089-42214111 TTGTGTATTGATGACAAATATGG + Intronic
1107811753 13:44207065-44207087 TTGTATTTAGTGAAGAAATAGGG + Intergenic
1108787150 13:53918564-53918586 TTGTATATGGAGAAGAGGAAGGG + Intergenic
1109224512 13:59676022-59676044 TTGAAGAAGTATAAGAAATAAGG - Intronic
1109633331 13:65081628-65081650 TTGAATATGGAAAATAAATATGG - Intergenic
1109917702 13:69013713-69013735 TTGAATATGAATAAGATACAAGG - Intergenic
1109926648 13:69149849-69149871 TTGTCAATGGATAAGAAACATGG - Intergenic
1109967206 13:69715884-69715906 TAGTATTTAGATAAGATATAAGG + Intronic
1110338629 13:74363129-74363151 AGGTATATGGATAAGATATAAGG - Intergenic
1110956104 13:81554416-81554438 TTTAATATAAATAAGAAATAGGG + Intergenic
1110958587 13:81590588-81590610 ATGTATATGTATAAGCATTATGG + Intergenic
1111025823 13:82521501-82521523 TTATCTTTGGATAAGAAATTGGG + Intergenic
1111525934 13:89470305-89470327 TTGTAAAGGAATAAAAAATAAGG + Intergenic
1111832950 13:93353093-93353115 TTGTATATGGGTGTGAAATTTGG + Intronic
1111998400 13:95187745-95187767 TTGTAGGTGTATAACAAATAGGG - Intronic
1112377420 13:98856017-98856039 TTGTATATGGAGAAGCTAAATGG + Exonic
1112974195 13:105297132-105297154 TTGTATAAAGATAATACATAGGG - Intergenic
1113703917 13:112412627-112412649 TTGTATATGGGTGAGAGATAGGG + Intronic
1114667139 14:24385350-24385372 TTATAAATGTATAAGGAATAAGG + Intergenic
1114862240 14:26538535-26538557 TTGTAAATGGATTAGAAATGGGG - Intronic
1115015277 14:28603983-28604005 TGGTCTATGGACATGAAATATGG + Intergenic
1115090646 14:29570442-29570464 TTGTATATGGAAAAACAATTTGG + Intergenic
1115101034 14:29700261-29700283 TTGTTTATGGAGTAGAAATTAGG - Intronic
1115192571 14:30761326-30761348 TAGTATGTGGATAATCAATAGGG - Intergenic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1115927764 14:38456037-38456059 TTGTATATGTTTGAGAAAAAGGG - Intergenic
1115948402 14:38692073-38692095 TTGTATTCCGATAAGAAAAAAGG + Intergenic
1118237045 14:64016186-64016208 TTTCACATGGACAAGAAATATGG + Intronic
1119277554 14:73372582-73372604 TTATATATGGAAAAGAGAAAAGG - Intronic
1120440018 14:84524631-84524653 TTAAATATGGAAAAGAAAAAAGG - Intergenic
1121488515 14:94340947-94340969 GTGTAGATGGAAAAGAAAAATGG + Intergenic
1121760284 14:96439225-96439247 ATGAATATGGAGAAGAGATAGGG + Intronic
1121899975 14:97684970-97684992 TAGTATATAGACAAGAAAGATGG + Intergenic
1121972945 14:98375503-98375525 ATGTATATTGATGAGAAATAGGG - Intergenic
1126545731 15:49871946-49871968 GAGTATATGGATAAGGTATAGGG + Intronic
1126932252 15:53667847-53667869 TTGTATTTGGGTAAGACATTAGG - Intronic
1127105731 15:55612411-55612433 TAGTATATGGATAAGAAAAAAGG + Exonic
1127245931 15:57174543-57174565 GTGTATGAGGACAAGAAATAAGG + Intronic
1129654217 15:77512553-77512575 AAGTATATGAATAAAAAATAGGG + Intergenic
1130094376 15:80845042-80845064 ATGTATATGGATAATATTTATGG - Intronic
1130865136 15:87927022-87927044 TTGGAAATGAATAAAAAATATGG + Intronic
1132723133 16:1326716-1326738 ATGTATATGGTTAATACATATGG + Exonic
1133422808 16:5661567-5661589 TTGTATATGTTTAAGGTATACGG + Intergenic
1134401250 16:13912296-13912318 TTATATATGGATATGAGATAAGG - Intergenic
1135107661 16:19664589-19664611 AGGTATATGGAAAAGAAACATGG + Intronic
1135524187 16:23201308-23201330 TTGTAAAAGTATAAGAACTAAGG + Intronic
1138279885 16:55764674-55764696 CTGGATATGGAGAAGAAATCAGG - Intergenic
1138773100 16:59688074-59688096 TTGCTTTTGGATAAGAAAGAAGG + Intergenic
1138860973 16:60756744-60756766 TTGTATATAGAAAATACATAGGG + Intergenic
1139073031 16:63406656-63406678 TTGTATATACATAAAAAATCTGG - Intergenic
1139099816 16:63751749-63751771 TTCTCTATGAAGAAGAAATATGG - Intergenic
1144012248 17:11160533-11160555 CTGCATATGCATAAGAACTATGG + Intergenic
1144141585 17:12354526-12354548 TTGAAAAAGGATAAGAAATCGGG + Intergenic
1144390363 17:14787886-14787908 TTTTGTATGTATAAGAAAAATGG - Intergenic
1146731547 17:35196985-35197007 TTGTATATGGTGTTGAAATAAGG + Intergenic
1147895354 17:43747413-43747435 TTTTATATCTAAAAGAAATATGG + Intergenic
1149648461 17:58258313-58258335 TTATATATGGGTAAAAGATAGGG + Intronic
1151020977 17:70617118-70617140 TTTGATGTGGGTAAGAAATATGG - Intergenic
1151071349 17:71216687-71216709 CTGAAAATGGATAAAAAATAAGG + Intergenic
1151585672 17:75006927-75006949 ATGTATATGGAAGAGAGATATGG - Intergenic
1151650690 17:75467426-75467448 TTGTATATGGAGAAAATATTAGG - Intronic
1152656432 17:81521542-81521564 TTGTATTTGTAGTAGAAATAGGG + Intronic
1153641373 18:7160715-7160737 TTGTATTTTGAGTAGAAATAGGG - Intergenic
1154950710 18:21206794-21206816 TTATATATTAATAAGTAATATGG - Intergenic
1155761234 18:29569846-29569868 TTGTATATAAATAAGAGATCTGG + Intergenic
1155975846 18:32130162-32130184 TTTTAAATGGACAAGCAATAGGG + Exonic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156861964 18:41847392-41847414 TGCTGTATGTATAAGAAATAAGG - Intergenic
1157145033 18:45153602-45153624 TTGGAAATGAATAACAAATAAGG - Intergenic
1157939450 18:51911186-51911208 TTGTAGATGGATAAAAATAATGG - Intergenic
1158566786 18:58560791-58560813 TTCCATAGGGAAAAGAAATAGGG + Intronic
1158722745 18:59940244-59940266 TTGTATGTAGAGAAGGAATAAGG - Intergenic
1159521054 18:69524820-69524842 TTGTTTATAGAAAAGAAATAGGG + Intronic
1162043345 19:7983614-7983636 TTGTTTATGGAGCAGAAAGATGG - Intronic
1168663473 19:58184813-58184835 TTTCAAATGAATAAGAAATAGGG + Intronic
925799886 2:7588186-7588208 TTGTATATGGTTTAGAGATGGGG - Intergenic
930603024 2:53463908-53463930 TTTTAAATGCATGAGAAATATGG + Intergenic
930683481 2:54283161-54283183 TTGTATATGTATGATAATTAGGG - Intronic
930684798 2:54296400-54296422 TTGTATAGGAACAAAAAATATGG + Intronic
931049388 2:58393607-58393629 TTTTGTATGGTTAAGAAAGATGG + Intergenic
931534127 2:63253202-63253224 TTGTATATGGTGAAAAGATATGG - Intronic
931865815 2:66409985-66410007 TTATATGTGGATAAGAAAACTGG - Intergenic
933228369 2:79777440-79777462 TTATATATGGATGAGAAAACTGG + Intronic
933872199 2:86577698-86577720 TTGTAAATGGAGAAGAAAAGGGG + Intronic
935488098 2:103683090-103683112 TTATATTTACATAAGAAATAAGG + Intergenic
935832104 2:107010936-107010958 TATTATAGGGAAAAGAAATATGG + Intergenic
939188051 2:138883480-138883502 TTGTATATAGCTAAGAAAATGGG - Intergenic
939658474 2:144856955-144856977 TTTTATATGAACAAGAAAAATGG - Intergenic
940076495 2:149748014-149748036 CTGTATATTAATAAGAAAAAAGG + Intergenic
940090777 2:149914270-149914292 TGGTAAATGCATAAAAAATATGG + Intergenic
940456090 2:153902596-153902618 TTGTAGAGGGATAAGAATGAAGG + Intronic
941344390 2:164348971-164348993 TTTCATATGGATTTGAAATATGG - Intergenic
942001660 2:171653911-171653933 TTGTATATAGTAAAGAATTATGG - Intergenic
942267076 2:174239110-174239132 TTCTAAATGTAGAAGAAATAAGG + Intronic
942509671 2:176684663-176684685 TTGTAAATGGAAAAGCAATTTGG - Intergenic
943418981 2:187643670-187643692 TTATATAGTGATAAGAACTATGG + Intergenic
947074835 2:226331201-226331223 TTGTCTAGGTATAAGAATTAAGG + Intergenic
947352904 2:229264865-229264887 TAGTAGATGGACAAGAAAGATGG + Intronic
947397864 2:229704001-229704023 TTGAATTTGAATCAGAAATATGG + Intronic
1169589369 20:7123131-7123153 GTGTATATGTGTTAGAAATAGGG + Intergenic
1169877351 20:10312539-10312561 TAGTCTATGGATAAGCAAAATGG + Intergenic
1170508037 20:17048701-17048723 TTGTATGAGGAAAAAAAATATGG + Intergenic
1173281231 20:41630025-41630047 TTGTATATGGTTAAAAAGTATGG + Intergenic
1174379531 20:50147738-50147760 TTCTTTATGGATGAGAATTAAGG - Intronic
1174626321 20:51917362-51917384 TTGTATATTTATTAGAGATAGGG - Intergenic
1174988135 20:55479068-55479090 ATGTATATAGATAAGATAAAGGG - Intergenic
1175610091 20:60343754-60343776 TTATAAATAGAAAAGAAATATGG - Intergenic
1175649954 20:60711880-60711902 TTGTATGTGGATATGAATTTTGG + Intergenic
1177972457 21:27807548-27807570 CTGCATATAGATGAGAAATATGG - Intergenic
1178302238 21:31462913-31462935 TTGTATTTGGAGTAGAGATAGGG + Intronic
1179453819 21:41484612-41484634 TTTTATATGAATAATCAATATGG + Intronic
1182143338 22:27981414-27981436 TTGTATATGGATAAACAACTTGG - Exonic
952876416 3:37948301-37948323 GTATATATGTATAAGGAATAAGG + Intronic
954930158 3:54274218-54274240 ATATATATATATAAGAAATACGG + Intronic
955180350 3:56662302-56662324 TTAAATATGAAAAAGAAATAAGG + Intronic
956390475 3:68767552-68767574 ATATATATTGATTAGAAATATGG + Intronic
956927108 3:74001507-74001529 TTTAATTTGGATAAGAAACATGG + Intergenic
957356669 3:79096960-79096982 TTGTATTTTGAAAAGAAATAAGG - Intronic
957500052 3:81044351-81044373 TAGTACATGGATATGAAACACGG + Intergenic
958001185 3:87750789-87750811 TTGTATTTGGATTTGAAATGCGG - Intergenic
958674401 3:97249192-97249214 TTGCCTATGTATAAGAAATATGG - Intronic
959627420 3:108468319-108468341 CTGTATACGTATAAGAAAAAAGG - Intronic
959734694 3:109645354-109645376 TTGTATATGCATAGAAAATATGG - Intergenic
960089389 3:113623742-113623764 TTGTTTTTGGATAAGAAAACTGG - Intronic
960308955 3:116097209-116097231 TTCTAGATGGAAAAAAAATATGG + Intronic
960668939 3:120138239-120138261 TTTTATATGTTTAAAAAATATGG + Intergenic
960674162 3:120178801-120178823 TTGAATAAGGATTAAAAATATGG - Intronic
962051685 3:131822458-131822480 TTATATATGGATATGAAATTGGG - Intronic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
963407130 3:144880285-144880307 TGGGACATGGATAACAAATAAGG - Intergenic
963619610 3:147589378-147589400 TTTTATTTGGTTAACAAATATGG - Intergenic
964635573 3:158854835-158854857 TTTTATATAGGTGAGAAATAGGG + Intergenic
964673958 3:159256959-159256981 TATTTTATGGATAAGAAAGAGGG + Intronic
965728118 3:171741663-171741685 TTGTATCTGGAAAGCAAATAAGG + Intronic
965846686 3:172970335-172970357 TTCTATAAGAATAAGATATAGGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967540697 3:190664431-190664453 GTATATATGGATCAGAAATTTGG + Intergenic
967665535 3:192167611-192167633 TCCTATATGGATTAGAATTAAGG - Intronic
970197406 4:13565600-13565622 TTGTATTTTCATAAGAAATGGGG + Intergenic
970267087 4:14300099-14300121 TAGTATATGGGTAAAAATTATGG + Intergenic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
971439931 4:26673352-26673374 TAGAATATGCATAAGAAATTTGG + Intronic
971625065 4:28909082-28909104 TTTTATATGTATGAGAATTAAGG + Intergenic
971646698 4:29216308-29216330 TTGGATATGTATAATAGATAGGG - Intergenic
972609409 4:40642893-40642915 TTGTATTTTTATTAGAAATAGGG + Intergenic
974410409 4:61534117-61534139 TTCTATATGGTTGAGAGATAGGG + Intronic
974653918 4:64793569-64793591 TTCTATGTGCAGAAGAAATAAGG + Intergenic
977048460 4:92095897-92095919 ATCTATATGCATGAGAAATAAGG - Intergenic
977105637 4:92880638-92880660 TTCTAGAGGGATAATAAATATGG + Intronic
977343106 4:95785453-95785475 TTCTTTATGGAAAAGAACTATGG + Intergenic
977395546 4:96466789-96466811 CAGAATATGGATAAGAAATTAGG - Intergenic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978230579 4:106392681-106392703 TTCTATCTGGATATGAAGTAAGG - Intergenic
978615394 4:110588366-110588388 TTATATAAGGATATGAAAGAAGG - Intergenic
979044253 4:115840949-115840971 TTGTATAGTGATTATAAATAAGG - Intergenic
979175904 4:117663362-117663384 TTGTATATCAATTTGAAATAAGG + Intergenic
979842138 4:125455231-125455253 TTAGGTATGGATAAGAAACATGG + Intronic
980243873 4:130212465-130212487 TTGTATATGTAGAAGAAATCTGG + Intergenic
980479491 4:133369319-133369341 TTATATATGCATAAGGAACAAGG + Intergenic
980501548 4:133661510-133661532 AGGTATTTGGATAAAAAATATGG + Intergenic
980563333 4:134505060-134505082 TTGTCTACAGATAAGAAACATGG - Intergenic
980718158 4:136655814-136655836 TTTTATATGGATAATAACTAAGG + Intergenic
982290310 4:153774308-153774330 TTGTTTATGGAATAAAAATATGG - Intergenic
982976053 4:162062570-162062592 TTCTATATGGATATAAAGTAAGG - Intronic
983514816 4:168644791-168644813 TAGCATATGCATCAGAAATAGGG + Intronic
983898560 4:173107773-173107795 TTTTAAATGGGTAAGAAACATGG + Intergenic
983963354 4:173780793-173780815 ATGTATAAGGAAAAGAAATATGG + Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984040107 4:174721917-174721939 GTGTATATATATAACAAATAGGG + Intronic
984350906 4:178591779-178591801 TTGAAAATGGATCAGAACTAAGG - Intergenic
984392086 4:179148936-179148958 TTGCATATTGATAATAAGTATGG + Intergenic
984480614 4:180296597-180296619 TTCTGTATGGAAAAAAAATAAGG - Intergenic
984515551 4:180734199-180734221 TTATATAAGCATAAAAAATATGG - Intergenic
984749632 4:183259364-183259386 TTTTAAATGGGTAAGTAATATGG - Intronic
987563933 5:19560480-19560502 TTGTATAAGGGTGAGAAATGAGG - Intronic
987678058 5:21101074-21101096 TTATATATTTATAAGAAAGAAGG + Intergenic
988017764 5:25581372-25581394 GTGTATATGGATCACAATTATGG + Intergenic
988075154 5:26342900-26342922 TTTTATATTCAGAAGAAATATGG + Intergenic
988557383 5:32249371-32249393 TTGTATATGGATGGCAAAAAGGG + Intronic
989202620 5:38779761-38779783 ATATATATTGATAAGAAAAAAGG - Intergenic
989766698 5:45093912-45093934 TTGTATATGCATCATAAAAAAGG + Intergenic
990409705 5:55529175-55529197 TTTTAAATGGACAAGCAATAGGG - Intronic
990749399 5:58997185-58997207 TTTTATATGGATAGCAAAAAAGG - Intronic
991060676 5:62371724-62371746 TTTTATATGGGTATGAAATAGGG + Intronic
991527122 5:67572568-67572590 AGATATATGGAAAAGAAATAAGG - Intergenic
992277704 5:75137246-75137268 TTGTCTATGGATAACAATAAGGG + Intronic
993807099 5:92424550-92424572 TTATACATGGATAACAGATATGG - Intergenic
994479407 5:100314650-100314672 TTGTATATGGTTAATAAAAAGGG - Intergenic
994992761 5:107017970-107017992 ATGGATGAGGATAAGAAATAAGG + Intergenic
995346609 5:111127642-111127664 TTGTTCATGGATCAGAAATGTGG + Exonic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
995660143 5:114472670-114472692 ATGTATATGGGGTAGAAATAAGG - Intronic
998232420 5:140369422-140369444 TGGAATATTGAAAAGAAATATGG + Intronic
998651860 5:144129539-144129561 TGGTATATGGGTAAGAACTTTGG + Intergenic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
999385202 5:151149239-151149261 TTGAAAATGGATAAGGAATGCGG + Intronic
999781174 5:154851705-154851727 TTGTATATGTAGTAGAAATGGGG - Intronic
1000092324 5:157940342-157940364 TTGTATATGGTATAAAAATAAGG + Intergenic
1000403606 5:160861674-160861696 TTTTCTATTGATAAGAAAAAAGG + Intergenic
1000516716 5:162244784-162244806 TTGTATATGTACAAGAAAATAGG + Intergenic
1000549546 5:162643278-162643300 TACTATATGGGTAAGAAACAGGG - Intergenic
1000689746 5:164302191-164302213 TATTATGTGAATAAGAAATATGG + Intergenic
1000752877 5:165118400-165118422 TTATATATGGATTATATATATGG + Intergenic
1002446494 5:179293338-179293360 TTGTTTATGGATCAGAAATCAGG + Intronic
1004126840 6:12882285-12882307 TTGGAGATGATTAAGAAATAGGG + Intronic
1005555496 6:26977209-26977231 TTTTAAAAGGAGAAGAAATATGG - Intergenic
1007023701 6:38547825-38547847 GTGAAGATGGATAATAAATAAGG - Intronic
1007263536 6:40580577-40580599 TTGTATATGGATGAGGAAACTGG - Intronic
1007523617 6:42471772-42471794 TAGTAACTGGATAAGTAATATGG - Intergenic
1008158287 6:48044995-48045017 TTGTATTTCTATAAGAAATGGGG - Intronic
1008718029 6:54312964-54312986 TTGTATATGGAGCAAAAATGAGG - Intronic
1009704272 6:67224860-67224882 CTCTATATAGATAATAAATAAGG + Intergenic
1010704226 6:79088707-79088729 ATGTATCTGCATAAGATATAAGG + Intergenic
1010900120 6:81417270-81417292 ATGTAAATGGAAAAGTAATAAGG + Intergenic
1010961070 6:82146369-82146391 ATTAATATGGATAAGAAACATGG - Intergenic
1011071268 6:83387087-83387109 TTGTTTATGGAAAAGAAACATGG - Intronic
1011145667 6:84213257-84213279 TTGTGTATATTTAAGAAATAGGG - Intronic
1011425808 6:87228601-87228623 TTGTATATGGTGCAGGAATAGGG + Intronic
1012270739 6:97207323-97207345 TTGTGTTTGTATATGAAATAGGG + Intronic
1012272587 6:97232878-97232900 TTGTATATAGAAAGGAAATTTGG - Intronic
1012470432 6:99567940-99567962 TTTTATATTGATAAGGTATAGGG - Intronic
1013480501 6:110549047-110549069 TTGTGTATATATAAGATATAAGG + Intergenic
1013876113 6:114831146-114831168 TATTATATGTATATGAAATATGG - Intergenic
1015458127 6:133452959-133452981 TTGCATTTGGTTGAGAAATACGG + Intronic
1015706956 6:136098562-136098584 TTTTATATGGATAAGTAACTTGG - Intronic
1016100503 6:140093571-140093593 TTGTACATGGATTAGATATAGGG - Intergenic
1016395163 6:143616732-143616754 TGGTATTTGGATAAGGAATGAGG + Intronic
1016640747 6:146346098-146346120 GTGTATCTGGAAAACAAATAAGG - Intronic
1017643740 6:156518860-156518882 TTGTATAGTGATAGGAAACAAGG - Intergenic
1020155241 7:5717981-5718003 TACTATCTGGATAAGAAAGACGG + Intronic
1020642329 7:10770796-10770818 TTGTATAGTGATGAGAAACATGG - Intergenic
1020969425 7:14916009-14916031 TAGTTTATGGATAAGTAAGATGG + Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021059869 7:16098604-16098626 TTGTATATGGTACAGAGATAGGG - Intronic
1022682569 7:32563675-32563697 TTTTATGTGGAAAAGAAAGATGG + Intronic
1023073451 7:36460396-36460418 TTGTATCTGGATTATAAATTTGG - Intergenic
1024224076 7:47312387-47312409 TTTTTAATGGAAAAGAAATACGG - Intronic
1025016989 7:55447619-55447641 ATGCATATGTATATGAAATATGG - Intronic
1026164733 7:67899810-67899832 TTGTGTATGGATAAAAGATGAGG + Intergenic
1026170908 7:67953192-67953214 TTACATAGTGATAAGAAATAGGG + Intergenic
1026658078 7:72274903-72274925 TTGTGTAAAGAGAAGAAATAGGG + Intronic
1027974939 7:85140947-85140969 ATGTATATGCATAGAAAATAGGG - Intronic
1028173901 7:87630381-87630403 TTGTAAATGGTAAAGTAATATGG + Intronic
1028238414 7:88388666-88388688 TTTTATAAGGCTAGGAAATAAGG + Intergenic
1028256556 7:88605519-88605541 TTGTATATGCATAAACAATGTGG + Intergenic
1028289089 7:89043044-89043066 TTGTATGTGTAAAACAAATATGG + Intronic
1028761991 7:94507531-94507553 TTTTAGATGGATACCAAATAAGG + Intergenic
1029329333 7:99838805-99838827 TTGTATATTTAGTAGAAATAGGG - Intronic
1029445221 7:100608137-100608159 ATTTATTTGGATAAGAAAGAAGG - Exonic
1029852433 7:103477179-103477201 TTGTTTCTGCATAGGAAATATGG + Intronic
1030299702 7:107962808-107962830 TTATATATAGTTATGAAATATGG - Intronic
1030778457 7:113566538-113566560 TTGTACATGACTGAGAAATATGG - Intergenic
1030971398 7:116061811-116061833 AGGTATATGGATAGCAAATAAGG + Intronic
1031661058 7:124424779-124424801 TAGTCAATGGATAAGAAATCTGG - Intergenic
1031674831 7:124596823-124596845 TTGTATTTGGAGGAGACATATGG - Intergenic
1031933500 7:127711485-127711507 ATATATAAGGATAAGAAATCAGG - Intronic
1032740659 7:134735158-134735180 TTGTATCTGGATATGAAAACTGG + Intergenic
1033291621 7:140089513-140089535 ATTTTTATGGAGAAGAAATATGG - Exonic
1033889226 7:145988304-145988326 TTGTGTGTGGAGAAGAAAGAGGG - Intergenic
1037266621 8:17069610-17069632 TTGTAGATGGTTAGCAAATATGG + Intronic
1037600718 8:20391601-20391623 TGGCATATGGATAAGGAAAAAGG + Intergenic
1038996920 8:32933662-32933684 GTGTATATAGATAAGACATTAGG + Intergenic
1039253824 8:35696260-35696282 TTAAATATTGATAATAAATATGG - Intronic
1040828645 8:51652249-51652271 TTGTAAAAGCAAAAGAAATAAGG - Intronic
1041598629 8:59688402-59688424 TTGTACAGGGATAAGTAATCTGG + Intergenic
1042576594 8:70227354-70227376 TTGTGGTTTGATAAGAAATAAGG + Intronic
1043291468 8:78606800-78606822 TTGCAAAAGAATAAGAAATAAGG - Intergenic
1043543297 8:81287307-81287329 TTGCATAAAGGTAAGAAATATGG - Intergenic
1043594352 8:81866413-81866435 TTGTAAATGAATAAAAATTAAGG + Intergenic
1043635887 8:82381500-82381522 TGCTATATGGAAAAGAAATAAGG - Intergenic
1044345876 8:91103718-91103740 TTGTATCTTTATAAGAAATAGGG + Intronic
1046089358 8:109480812-109480834 TTGTATTTTGATTAGACATATGG + Intronic
1046647700 8:116803966-116803988 ATGTATATGACTAGGAAATACGG + Intronic
1048183234 8:132215282-132215304 TTATGTATGGGAAAGAAATATGG + Intronic
1048273623 8:133048978-133049000 TTGGAAATGGAAAAGAAAGAAGG - Intronic
1048734570 8:137484564-137484586 ATTTATATGGATAAAAGATATGG - Intergenic
1048951317 8:139499173-139499195 TTGTTCTTGGATCAGAAATATGG - Intergenic
1049153328 8:141050519-141050541 TTGAAAATGAACAAGAAATAAGG + Intergenic
1050689510 9:8209466-8209488 TTGAAAATGAATGAGAAATATGG - Intergenic
1050806696 9:9689133-9689155 TTGTATAACGATAAAAATTATGG + Intronic
1051993300 9:23180418-23180440 TTATATATTGATAAGGAAGATGG - Intergenic
1052194541 9:25695497-25695519 CTGTCTAGGGATAAGAAAAAGGG + Intergenic
1052499992 9:29276408-29276430 TTGAATATGGATATGAATTTTGG + Intergenic
1052531459 9:29689632-29689654 TTTTATAATGATAAAAAATATGG - Intergenic
1052551769 9:29959844-29959866 TTGTTTATGGATAAGAAATCTGG + Intergenic
1055009701 9:71551537-71551559 TTGAATCTGGAGAACAAATAGGG + Intergenic
1055153832 9:73036805-73036827 CTAAATATGGTTAAGAAATAAGG - Intronic
1056367998 9:85925305-85925327 TTGTATCTGGATAAAATAAATGG + Intergenic
1057347559 9:94264437-94264459 TTGTATATGTTAAAGAAATTAGG + Intronic
1057621187 9:96636953-96636975 TTGTATTTGTAGTAGAAATAGGG + Intergenic
1057665568 9:97042387-97042409 ATGTAAATGCAGAAGAAATATGG + Intergenic
1058304890 9:103427573-103427595 TGGTATTTGGAGAAGATATACGG - Intergenic
1058514482 9:105755718-105755740 TTGTATATTGAAAACAAAGATGG - Intronic
1062484370 9:136767516-136767538 TTGTATTTTGAGAAGAGATAGGG - Intergenic
1187034084 X:15519368-15519390 TTCTACATGGATATGAAATTTGG - Intronic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1188135224 X:26486093-26486115 TTATAAATAAATAAGAAATATGG - Intergenic
1189080847 X:37970809-37970831 TTGTATATGCTTATGAAATATGG - Intronic
1189928436 X:45982307-45982329 TTGTTTATGAATATGAAATTTGG - Intergenic
1191771722 X:64767639-64767661 TTGTATTTTTATTAGAAATAGGG - Intergenic
1192661998 X:73051686-73051708 TTGTATAATGGTAAGATATAGGG - Intergenic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1193944492 X:87717417-87717439 ATGTATATTGCTTAGAAATATGG - Intergenic
1194625781 X:96225596-96225618 GTGTATAAGAATAAAAAATAGGG + Intergenic
1194802855 X:98293359-98293381 CTGTATATGGATCAGGAATATGG - Intergenic
1195642431 X:107191296-107191318 TTATCTATGAATGAGAAATATGG - Intronic
1195656281 X:107334289-107334311 TTGGATATGAATATGAGATATGG + Intergenic
1196383171 X:115116748-115116770 TTGTATGTGGTTAAAAAGTATGG - Intronic
1197195449 X:123695106-123695128 TTATATATGACTAAGAAAGAGGG - Intronic
1197644702 X:129004867-129004889 TGCTATAGGGATAGGAAATATGG - Intergenic
1197718719 X:129729648-129729670 TTGTATTTGGATATGACATGAGG - Intergenic
1197846192 X:130805624-130805646 GTGTCTATGGATATGACATATGG - Intronic
1197916010 X:131536199-131536221 TTGTATATGGAAGACAACTAAGG - Intergenic
1197966011 X:132062501-132062523 ATGTAAATGGATAAGAAAAAGGG - Intergenic
1198715847 X:139557441-139557463 TGGTGGATGGCTAAGAAATATGG - Intronic
1199714303 X:150495426-150495448 TTGGATATGCAGAAGAAATATGG + Intronic
1201354190 Y:13080857-13080879 TTAAACATGGAAAAGAAATAAGG - Intergenic
1201755356 Y:17481099-17481121 TTGTATGTGGATAAACAAAAGGG - Intergenic
1201846196 Y:18424886-18424908 TTGTATGTGGATAAACAAAAGGG + Intergenic
1202348051 Y:23955921-23955943 TTGTATATTTAGTAGAAATAGGG + Intergenic
1202522723 Y:25714183-25714205 TTGTATATTTAGTAGAAATAGGG - Intergenic