ID: 1093376069

View in Genome Browser
Species Human (GRCh38)
Location 12:18429472-18429494
Sequence ACCCTCTCCCAGCCACCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093376066_1093376069 11 Left 1093376066 12:18429438-18429460 CCTAGGATGTCACATCATCAGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG 0: 1
1: 0
2: 1
3: 24
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093376069 Original CRISPR ACCCTCTCCCAGCCACCATC TGG Intronic
900389800 1:2428969-2428991 GCCCTCTCCCTGCCATCTTCTGG + Intronic
900410303 1:2509676-2509698 ACCCTCCCCAGGCCACCTTCGGG + Intronic
900435713 1:2629593-2629615 GCCCGCTCCCAGCCAGCATCCGG - Intronic
900788190 1:4662920-4662942 ACCCTCTCCCCTCCACCTCCAGG - Intronic
901298390 1:8179016-8179038 TCCCTCTCCCTGCCAAGATCTGG + Intergenic
901492801 1:9605190-9605212 ACCCAATCCCAGCCCACATCAGG - Intronic
901898123 1:12332609-12332631 ACCCTCTCCCACCCAACTCCAGG - Intronic
902079205 1:13809620-13809642 ACCCACGCCCAGCCCACATCTGG - Intronic
903017789 1:20372854-20372876 GCCGCCTCCCAGCCATCATCTGG - Intergenic
903316756 1:22514034-22514056 CCCCTCTCCCTGCCCCCTTCAGG - Intronic
904700649 1:32355940-32355962 GCCCTCTCCCACCCACCATTAGG - Intronic
905309870 1:37041982-37042004 ACTCTCTCCAAGCCTCCAGCAGG + Intergenic
907414075 1:54302032-54302054 ACCCCCACCCAGCCGCCCTCTGG - Intronic
908154990 1:61343979-61344001 AGCCTCTCACAGCCACAGTCAGG + Intronic
908462385 1:64357700-64357722 ACCCTCTACCAGCCCCTAACAGG - Intergenic
909423984 1:75499972-75499994 AACCCCTCCCATCCACTATCTGG + Intronic
910194455 1:84625630-84625652 ACCCTCCCCCAGCCAGGGTCAGG + Intergenic
912707600 1:111926543-111926565 AGCCCCTCCCTGCCACCACCAGG - Intronic
913110836 1:115655760-115655782 ACCCTCTCCCAGACAGCACTTGG + Intronic
914944149 1:152048604-152048626 TCCCTCCCCCTGCCACCAGCTGG - Intergenic
915366517 1:155319922-155319944 ACCCTCTCTCAGGCACCTTCAGG - Exonic
916541143 1:165755738-165755760 TCCCTTTCCCATCCACCTTCTGG + Intronic
917951354 1:180040211-180040233 ACCCTCTACCAGGCAACATCTGG - Intronic
920002273 1:202808055-202808077 TCCCTCCCCCAGCCACGAGCTGG + Intronic
920172075 1:204078420-204078442 CCCCTCCCCCAGCCACATTCAGG + Intronic
920230497 1:204466803-204466825 AGACTCCCCCAGCCAGCATCGGG - Intronic
920646983 1:207811133-207811155 AGCCACTCCTAGCCCCCATCTGG + Intergenic
920672273 1:208013611-208013633 ACCCCCTTTCAGCCAGCATCTGG - Intergenic
921946463 1:220889238-220889260 ACCCTCTGCCAGCCACTCTTGGG + Intergenic
1064220143 10:13433397-13433419 ACCCTCTCACAGACACATTCAGG - Intergenic
1064284215 10:13978421-13978443 ACTCTCTCACACCCACCATGGGG + Intronic
1064564386 10:16625249-16625271 ACTCTCTCCCAGTCACCAACTGG + Intronic
1065847981 10:29761923-29761945 AACCTGACCCAGCCACCAGCTGG - Intergenic
1067430664 10:46241352-46241374 ACCCTGCCACTGCCACCATCAGG + Intergenic
1067662088 10:48243759-48243781 ACCCTCTCCAATTCAACATCCGG - Intronic
1067830093 10:49606642-49606664 TCCTGCTCCCAGCCACCATGTGG - Intergenic
1070659163 10:78292602-78292624 AACCTGTCCCAGACCCCATCGGG - Intergenic
1070816378 10:79327279-79327301 AACCCAGCCCAGCCACCATCTGG + Intergenic
1073457573 10:103646961-103646983 GCCATCTCCCAGCCTCCATGGGG + Intronic
1075004199 10:118818746-118818768 ACCCTCCGTTAGCCACCATCTGG + Intergenic
1076801065 10:132828858-132828880 TCCCTTTGCCAGCCACCACCCGG + Intronic
1077412712 11:2410946-2410968 AGGCTGTCCCAGCCATCATCCGG - Intronic
1077491292 11:2862209-2862231 ACCCTACCCCTGCCCCCATCCGG - Intergenic
1077636640 11:3846288-3846310 TCCCTCTCTCAGCCAGCCTCAGG + Intergenic
1079077268 11:17391782-17391804 AGCGTCTCCCAGACACCACCTGG + Intergenic
1082719728 11:56659154-56659176 CCCTTCTCCCACCCTCCATCAGG + Intergenic
1083883509 11:65559417-65559439 ACCCTCTCCCGGACAGCACCCGG + Intergenic
1084182252 11:67452624-67452646 ACCGTGTCCCAGCCACCTTGGGG + Exonic
1086599718 11:88617861-88617883 AGCCTCTCCCACCCACCTCCTGG - Intronic
1087801154 11:102506111-102506133 CCCTTCTCCCACCCTCCATCAGG + Intergenic
1087993741 11:104778344-104778366 ACCATCTCACAGCCACTAACTGG + Intergenic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1088648398 11:111936796-111936818 TCCCTTTCCCACCCACCTTCTGG + Intronic
1088963575 11:114695434-114695456 ACCCAAACCCAGCCTCCATCTGG - Intronic
1089023656 11:115244670-115244692 ACTCTTTACCAGCCAGCATCAGG + Intronic
1089981360 11:122775477-122775499 ACCCACTTCCAACCACCACCAGG - Intronic
1090084733 11:123641119-123641141 GCCCTCTCCTGGTCACCATCTGG - Intronic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1092227688 12:6758804-6758826 ACCTGCTCTAAGCCACCATCAGG - Intronic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1093646382 12:21590076-21590098 CCCCACTTGCAGCCACCATCTGG + Intronic
1093819863 12:23601125-23601147 ACACTCCCCAAGCCACCAACTGG + Intronic
1095970818 12:47901056-47901078 ATCCTCTCCCAGCCAGCCTTGGG + Intronic
1097232881 12:57522946-57522968 ACCCCCTCCCACTCACCCTCTGG + Exonic
1097250032 12:57627510-57627532 ACCCGCGCCCAGCCGCCAGCGGG - Intronic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1104329246 12:127828823-127828845 TCCCTCTGCCAGCCACCGTGAGG + Intergenic
1104706540 12:130951690-130951712 ACCCTCCCCCATCAGCCATCGGG + Intergenic
1106773569 13:32986616-32986638 AGCCTCTCCCAGGCACCAGAAGG - Intergenic
1107915773 13:45148685-45148707 ACCCTGTCCCAGCCAGCAGAAGG - Intronic
1109380439 13:61552130-61552152 ACCCCCTCCCACTCACCATTTGG - Intergenic
1113991899 14:16034569-16034591 ACCCTCCCCCAACCCCCAACTGG + Intergenic
1115025176 14:28736303-28736325 ACCCTCTCACAGCCACCTCAAGG + Intergenic
1115343494 14:32317711-32317733 AGTCTCTCCCAGGCACCATCTGG + Intergenic
1116651083 14:47593719-47593741 ACCCTCCCCCATCCCCCAACAGG - Intronic
1118255930 14:64205845-64205867 AACAACTCCAAGCCACCATCTGG - Intronic
1119553214 14:75532323-75532345 ACTGTCCCCCAGCCATCATCAGG + Intronic
1119620817 14:76130805-76130827 CCCCTTTCCCACCCACCTTCTGG + Intergenic
1119820900 14:77615943-77615965 AGCCTCTCCCAACCACATTCTGG - Intronic
1120138868 14:80904324-80904346 CCCCTCTCCCCGCCACCCTCTGG - Intronic
1121850944 14:97220567-97220589 CCCCTCTGCCAGGCACCAACAGG - Intergenic
1122049127 14:99043152-99043174 ATCCTCTCCCAGTCACTTTCGGG - Intergenic
1122203888 14:100138758-100138780 ACCCTGTCCCTTCCACCATGTGG - Intronic
1122307264 14:100773763-100773785 AGCCTCTCCCAGCCCCTAGCTGG + Intergenic
1122657340 14:103270901-103270923 CCCTCTTCCCAGCCACCATCTGG + Intergenic
1122900335 14:104779749-104779771 ACCCCCGCCCAGCCAGCCTCAGG + Intronic
1123676344 15:22713999-22714021 ACCCTGTCCCTGACACCTTCTGG + Intergenic
1124134011 15:27018028-27018050 AGCTTCTCCCTTCCACCATCTGG - Intronic
1124328562 15:28788261-28788283 ACCCTGTCCCTGACACCTTCTGG + Intergenic
1125603446 15:40927716-40927738 CACCCCTCCCAGCCACCATCTGG - Intergenic
1128224121 15:65989816-65989838 ACCCTCCCCAAGACAGCATCTGG + Intronic
1128562408 15:68677522-68677544 AGCATCCCCCCGCCACCATCTGG - Intronic
1128876122 15:71202775-71202797 ACCCCCTCCCCGCAACCACCAGG - Intronic
1129310972 15:74708738-74708760 ACCCCCTCTCCTCCACCATCTGG - Intergenic
1129672184 15:77613463-77613485 ACCCCGCCCCAGGCACCATCAGG - Exonic
1130028809 15:80293849-80293871 ACCCTCATTCAGCCACCAACTGG - Intergenic
1131826093 15:96323283-96323305 GCCCTCTCACAGCCACTATCAGG - Intergenic
1132237111 15:100230378-100230400 ACTCTGTACCAGCCAGCATCTGG - Intronic
1133074165 16:3267078-3267100 CCCATATCCCAGCCAACATCAGG + Intronic
1135187234 16:20325881-20325903 ACCCTCTCCCACCCTCCTCCAGG + Intronic
1135241039 16:20807144-20807166 ACCCTCGCCCAACCGCCGTCGGG + Intronic
1136989075 16:35140941-35140963 AGACTCTCCCACACACCATCTGG - Intergenic
1138315207 16:56063984-56064006 ACCCTTACCCAGCCAGCCTCAGG + Intergenic
1139933641 16:70550760-70550782 ACCCTCTGAAAGACACCATCAGG - Intronic
1140657980 16:77159739-77159761 ATGCTCTCCCAGTCACCATATGG + Intergenic
1141893995 16:86946973-86946995 CCCCTCTCCCCCACACCATCAGG + Intergenic
1141922221 16:87143823-87143845 ACCCTCTCCCCTCAACCGTCAGG - Intronic
1142034203 16:87853765-87853787 ACCCACTCCCCGCCTCCCTCCGG - Intronic
1142685064 17:1572784-1572806 TCACTCTCCCACCCACCCTCAGG - Intronic
1142687857 17:1588010-1588032 TCACTCTCCCACCCACCCTCAGG - Intronic
1143255607 17:5555551-5555573 TCCCCCGGCCAGCCACCATCTGG + Intronic
1143452345 17:7043467-7043489 ACCCAGCCCCAGCCCCCATCCGG + Exonic
1143477450 17:7211035-7211057 AACCTCTTCCAGCCACATTCTGG - Intronic
1143492465 17:7292421-7292443 CCCCTCCCCCAACCCCCATCAGG + Intronic
1143954529 17:10658087-10658109 ACCCCATCCCAGCCAGCAGCTGG - Intergenic
1144993349 17:19249293-19249315 TCTCCCTCCCAGCCACCCTCAGG - Intronic
1146002428 17:29139348-29139370 ACTCTCCCCCAGCCACCCCCGGG - Intronic
1146619994 17:34389676-34389698 GCTCTCTCCCAGCTTCCATCTGG + Intergenic
1147383564 17:40069582-40069604 ACCCTCCCCCAGCAGCCAGCGGG - Intronic
1149141557 17:53437941-53437963 TCCCTCTGCCAGCCAGCATCAGG + Intergenic
1151346551 17:73506203-73506225 AGCCTCTCCTGGCCACCACCTGG - Intronic
1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG + Intergenic
1152569668 17:81116154-81116176 CTCCCCTCCCAGCCACCAGCTGG - Intronic
1152572019 17:81125067-81125089 ACCCTCCCCCTGCCCCCACCCGG - Intronic
1152574996 17:81136133-81136155 CCCATCTCCCAGGCTCCATCTGG + Intronic
1152597269 17:81243863-81243885 ACCCCCTCCCAGCCTCCTCCCGG + Intergenic
1153856076 18:9148689-9148711 ATCCTCCCCCCGCCACAATCTGG + Intronic
1155164115 18:23218861-23218883 CCCCTTCCCCAGCCTCCATCAGG - Intronic
1156485434 18:37462624-37462646 CCCCTCTCCCAGCAAACATGAGG - Intronic
1156506596 18:37599735-37599757 ACCCTCTCTCACACATCATCTGG - Intergenic
1157587774 18:48816145-48816167 ACCTTCTCCCTGGGACCATCAGG + Intronic
1158416930 18:57256929-57256951 AACCACTGCCAGCCATCATCTGG - Intergenic
1161238175 19:3208147-3208169 ACCATGTCCACGCCACCATCGGG - Exonic
1162577539 19:11507626-11507648 AGCCTCTCCCATGCACCCTCAGG + Intronic
1162729023 19:12706516-12706538 ACTCTCCCCCGGCCACCCTCTGG - Intronic
1163546032 19:17942046-17942068 TCCCTCATCCAGCCAGCATCAGG + Intronic
1164147144 19:22518967-22518989 AGCCTCCCCCAGCCACCACCAGG - Intronic
1164159488 19:22617362-22617384 AGCCTCCCCCAGCCACCACCAGG + Intergenic
1164898153 19:31895608-31895630 ATCCTCACCCAGCCAAGATCTGG + Intergenic
1165120656 19:33556488-33556510 TCCCTCCCACAGCCCCCATCTGG - Intergenic
1166085604 19:40472703-40472725 TCCCGCTCCCAGCCCCGATCCGG - Exonic
1166499554 19:43330704-43330726 AGCCTCTCCCTGCTACAATCTGG - Intergenic
1166784031 19:45357254-45357276 AGCCTCTCCCACTCACCATAGGG + Exonic
1167415796 19:49371293-49371315 ACCCTGGCCCAGCAACCATCTGG + Intronic
1168291837 19:55360957-55360979 ACCTTCTCCCACCCACCCACCGG + Intronic
925795664 2:7539630-7539652 ACCCTATCCCTGCCCCCACCTGG - Intergenic
927855984 2:26528249-26528271 ACCCTCTCCCAACCCCCCTCAGG - Intronic
930001317 2:46863550-46863572 GCCTTCTCCCAGCCAGCCTCGGG - Intergenic
930002276 2:46869452-46869474 ACCCTCTTCCAGCCTCACTCAGG + Intergenic
935633876 2:105235015-105235037 AGAGTCTCCCAGCCACCAGCTGG + Intergenic
937296565 2:120813032-120813054 ACCCTTTCACAGCCATCGTCTGG - Intronic
939088953 2:137756874-137756896 ACACACTACCAGCTACCATCTGG + Intergenic
939680752 2:145129216-145129238 ACCCTATTACAGCCACCACCAGG - Intergenic
941040707 2:160619670-160619692 CCCATCTCCCATCCACCATGTGG - Intergenic
945347094 2:208731576-208731598 ACCCTGCCCCTGCCACCACCAGG - Intronic
946030150 2:216697127-216697149 TCCCTCTCCCAGCCACCACGTGG - Intergenic
947661811 2:231875087-231875109 ACCCTCTCCCAGCTACCTCTTGG - Intergenic
948607250 2:239143950-239143972 ACCCATTCCCAACCACCACCAGG - Intronic
948762653 2:240202008-240202030 CCCCTCGCCCAGCCGTCATCAGG - Intergenic
948892597 2:240914697-240914719 ACCCCCGCCCACCCACCAGCAGG - Intergenic
1169000314 20:2163548-2163570 TCCCCCTCCCAGCCACCGCCTGG - Intronic
1169162023 20:3388778-3388800 TCCCTCTCCCATCCAGCACCTGG - Intronic
1170188956 20:13625573-13625595 ACCCTGTCCCCGACACCTTCTGG - Intronic
1170525127 20:17228712-17228734 CCTCTCTCCCAGCCACCGCCAGG + Intronic
1170632499 20:18077438-18077460 ACATTCTCACAGCCACCATGTGG + Intergenic
1171020533 20:21580813-21580835 AGCCTCTCCCTGCACCCATCTGG + Intergenic
1171769961 20:29314699-29314721 ACCCTCCCCCAACCCCCAACTGG - Intergenic
1172046566 20:32084573-32084595 TCCCTCTCCCCTCCACCCTCTGG - Intronic
1172109253 20:32535938-32535960 ACCCTCTCCCTGCCCCCGCCAGG - Intronic
1172510439 20:35497181-35497203 AACCCCTGCAAGCCACCATCTGG - Intronic
1174542763 20:51303089-51303111 ACCCTCTCCCAGAAGCCATCTGG + Intergenic
1174656823 20:52178681-52178703 ACCCCCTCCAAACCACCATTAGG + Intronic
1175220172 20:57412186-57412208 TGCCTCTCCCAGCCCCCAGCTGG - Intergenic
1175533796 20:59693140-59693162 ACCCTGAGCCAGCCACTATCAGG - Intronic
1175730524 20:61350685-61350707 TGCCTCTCCCACCCAGCATCAGG + Intronic
1175840334 20:62022514-62022536 ACCCTCTCCATGCTACCAGCTGG + Intronic
1176045132 20:63088579-63088601 ACCCTCTCCCAGCAAGCTCCGGG - Intergenic
1177828182 21:26107041-26107063 ATCCTTTCCCCGCCACCCTCAGG - Intronic
1179950852 21:44708176-44708198 TCCCTCCCCCAGCCCCCAGCAGG + Intronic
1180315373 22:11272957-11272979 ACCCTCCCCCAACCCCCAACTGG - Intergenic
1181602035 22:23958458-23958480 ACCCACTCTCTGCCCCCATCAGG - Exonic
1181623504 22:24106595-24106617 ACCCTCATCCTGCCACCAGCTGG - Intronic
1181918735 22:26302427-26302449 ATACTCTCTCAACCACCATCAGG - Intronic
1182926475 22:34129982-34130004 ACCTGTCCCCAGCCACCATCTGG + Intergenic
1184403300 22:44286266-44286288 ACCCTCTCTCAGCCTCCCCCAGG + Intronic
1184644104 22:45886809-45886831 CCCCTCCCACAGCCACCATATGG + Intergenic
949250614 3:1979308-1979330 TCCCTCCCCCACCCACCAACAGG - Intergenic
950362895 3:12462375-12462397 CTCCTCTCCCTGCCACCACCGGG + Intergenic
950549738 3:13658981-13659003 GCTCCCTCCCAGGCACCATCGGG - Intergenic
950936012 3:16839967-16839989 CACCTCTCCCAGCTAGCATCTGG - Intronic
953930489 3:47003451-47003473 AGACTCTCCCACTCACCATCTGG - Intronic
954872065 3:53774890-53774912 ACCTTATGCCAGCCACAATCGGG - Intronic
959096050 3:101957268-101957290 TGCCTCTCCCAGCCACTCTCTGG + Intergenic
960782036 3:121330442-121330464 AACCTGACCCAGCCACCACCTGG + Intronic
961658658 3:128456991-128457013 ACCCTCCCCCAGCCCCCTCCAGG + Intergenic
963254136 3:143127897-143127919 ACGCTCTCTCAGCCTCCAGCCGG - Intergenic
963807773 3:149743034-149743056 ACCATCTCCCAGCCACCTGAAGG - Intronic
968595411 4:1479693-1479715 ACCCCCTCCAGGTCACCATCTGG - Intergenic
968830660 4:2931653-2931675 ACCCGCTCCCAGCCTACAGCAGG - Exonic
969373061 4:6746451-6746473 TCCCACTCCCAGCCAGCATCAGG - Intergenic
969451761 4:7277846-7277868 AGGCACTCCTAGCCACCATCAGG - Intronic
969832585 4:9809612-9809634 ACCTTCTCCCAGCCTCCCTTGGG + Intronic
971381865 4:26106543-26106565 ACCCCATCCGAGCCACAATCAGG - Intergenic
972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG + Intergenic
976215270 4:82710236-82710258 ACCCTCTCTTAGACACCATGTGG + Intronic
977462530 4:97342860-97342882 ACCCTAACCCCGCCACCAACAGG - Intronic
982174216 4:152690139-152690161 CCCCTCTCCCTGTCACCTTCTGG - Intronic
983144064 4:164190288-164190310 GCCCTCTCCCAGCCACGAAGAGG + Intronic
984004107 4:174287420-174287442 TCCCTCTCCCATTCTCCATCTGG - Intronic
985166170 4:187097073-187097095 AGCCTCTACCAGCCATGATCCGG + Intergenic
990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG + Intergenic
990610674 5:57453899-57453921 ACCCTCTGCCAGCCAGGGTCTGG - Intergenic
993900206 5:93579757-93579779 ACCCCCTCCCCGCCCCCAGCCGG + Intergenic
994256819 5:97606808-97606830 ACCCTTTCACAGCCACCTTTAGG - Intergenic
997618331 5:135268509-135268531 CACCGCTCCCAGCCAGCATCCGG - Intronic
997715612 5:136040542-136040564 CCCTTCCCCCTGCCACCATCTGG + Intronic
1001920224 5:175594080-175594102 ACCCTCTTCCAGCCACCCCTTGG + Intergenic
1001934591 5:175695166-175695188 ACCCTCTCCCAACAACTACCTGG + Intergenic
1002259440 5:177983581-177983603 ACCCCCTCACAACCAGCATCTGG - Intergenic
1002277942 5:178115302-178115324 AGCCTCTCCCAGCCCCTCTCTGG + Intronic
1003041103 6:2687986-2688008 ACCCTCTCCCCACCCCCAGCAGG + Intronic
1004020447 6:11771460-11771482 AGCCTCTCCCAGGCTCCATGGGG + Intronic
1004856302 6:19754048-19754070 ACCTTCTGACAGGCACCATCTGG - Intergenic
1005199644 6:23329301-23329323 CCACTCTGCCAGCCTCCATCTGG + Intergenic
1006511029 6:34521263-34521285 AGCTGCTCCCAGCCACCAGCAGG - Intronic
1007521270 6:42452960-42452982 ACCCCTTCCCCGCCCCCATCGGG - Intergenic
1007861408 6:44913108-44913130 CCCCTCTCCCATCTACAATCAGG - Intronic
1009045992 6:58237913-58237935 ACCCTTCCCCAGGCACCATCTGG + Intergenic
1009221805 6:60992226-60992248 ACACTTTCCCAGGCACCATCTGG + Intergenic
1010154126 6:72772561-72772583 ATCCTTTACCAGCCTCCATCTGG + Intronic
1015211993 6:130708920-130708942 ACCCTCTTCCCTCCACCCTCTGG - Intergenic
1019343695 7:519851-519873 ACCCTCTCCCCGCCGCCGGCCGG - Intronic
1019402062 7:860945-860967 ACCCGCTCCCTGCCACAATGTGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020137899 7:5596696-5596718 GCCCTCTCCCAGCCACTCTGAGG + Intronic
1021692795 7:23247203-23247225 ACCCTCCCCCAACCACTGTCTGG - Intronic
1023861395 7:44219558-44219580 CCCCTCTCCCATCCACCCCCAGG + Intronic
1024511283 7:50207006-50207028 ACCCACCCCCAGCCCCCACCAGG + Intergenic
1024717213 7:52093045-52093067 ACCCTCTCCCAGACAGCACCTGG - Intergenic
1024776057 7:52787476-52787498 TCCCTATCCCAGCCACCCACAGG - Intergenic
1025854197 7:65264010-65264032 ACCCTCTACTAGCAACCATGGGG + Intergenic
1025866920 7:65390906-65390928 AACTTCTCCCAGCCACAGTCTGG - Intronic
1025927062 7:65968666-65968688 AACCTCTGCCTCCCACCATCAGG + Intronic
1031153751 7:118085152-118085174 AACTTCTCCCACCTACCATCTGG + Intergenic
1031965781 7:128027307-128027329 TCCCTCTCCCAGGCCCCCTCAGG - Exonic
1032390446 7:131552347-131552369 AGCCACTCCTAGCCACCCTCAGG - Intronic
1032913384 7:136459566-136459588 ACCCTCTCTCATCTACCAACTGG - Intergenic
1033602451 7:142897941-142897963 ACCCTGCCCCAACCACCACCAGG - Intergenic
1034448751 7:151126405-151126427 AGCCTCTCCCAGCCTTCAGCAGG - Intronic
1035319884 7:158022002-158022024 AGCCTCGCCCATCCACCATGAGG + Intronic
1035636055 8:1145235-1145257 TGCCCCACCCAGCCACCATCCGG + Intergenic
1035655420 8:1301603-1301625 ACCCTCTCCCAGAGTCCATCAGG - Intergenic
1037752663 8:21692834-21692856 GCCCTCTGCCAGCCCCCAGCGGG + Exonic
1038036367 8:23690057-23690079 GCCCTCTGCCAACCACCAGCTGG - Intergenic
1038959086 8:32498783-32498805 GCCCTCTCCCCCACACCATCAGG - Intronic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1048209682 8:132444277-132444299 CTCCTCACCCAGCCACCAACTGG + Intronic
1048440930 8:134458475-134458497 ACCCTCTCCCCCTCTCCATCAGG - Intergenic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1051357828 9:16255578-16255600 ACCCTGTCCAAGCCACCATCTGG + Intronic
1053073418 9:35114501-35114523 ACCCTCTCCCAGCCAGCCCAGGG + Intronic
1056277083 9:85003864-85003886 CCCATATCCAAGCCACCATCAGG - Intronic
1057440306 9:95078205-95078227 AGCCTCTTCCACCCGCCATCTGG + Intronic
1058529209 9:105889240-105889262 GCCCCCTCCCAGCCTCCATGGGG - Intergenic
1059032661 9:110715963-110715985 TCCCACTCCCAGCCTCCAACAGG - Intronic
1059084261 9:111283299-111283321 CTCCTCACCTAGCCACCATCTGG + Intergenic
1061016408 9:127983236-127983258 CCCCTTCCCCAGGCACCATCAGG - Intergenic
1061884623 9:133585323-133585345 ACCCCCTGCTAACCACCATCTGG + Intronic
1062521941 9:136961593-136961615 GCGCCCTCCCGGCCACCATCTGG + Intergenic
1062606625 9:137351386-137351408 GCACTCTCGCAGCCACCAACAGG - Exonic
1062725964 9:138073684-138073706 ACCCTCTCCCAGCCTCCCAAAGG - Intronic
1203363664 Un_KI270442v1:238868-238890 ACCCTCCCCCAACCCCCAACTGG - Intergenic
1186221469 X:7354012-7354034 ACCTTCTCCCAGGCCCAATCTGG + Exonic
1188580427 X:31705237-31705259 TCCATCTACCACCCACCATCAGG - Intronic
1189847101 X:45148071-45148093 ACCCTCCCCCACCCACCCTGTGG - Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1192458764 X:71299812-71299834 ACCCACTCCTACCTACCATCAGG + Intronic
1193866171 X:86732992-86733014 ACCCTTCTCCAGCCCCCATCAGG - Intronic
1194556619 X:95368150-95368172 AGCCTGTCCCAGCCCCCACCTGG + Intergenic
1195082918 X:101387638-101387660 CACCTCTCCCAGCCATCAACAGG + Intronic
1197266480 X:124379365-124379387 AACATCTCCCAGCCATCTTCAGG - Exonic
1201074653 Y:10177962-10177984 ACCCTCCCCCAACCCCCAACTGG + Intergenic