ID: 1093378324

View in Genome Browser
Species Human (GRCh38)
Location 12:18458683-18458705
Sequence AGCAAAGATTTGCCTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093378321_1093378324 -8 Left 1093378321 12:18458668-18458690 CCTTGAGCCCTTATAAGCAAAGA 0: 1
1: 0
2: 2
3: 23
4: 145
Right 1093378324 12:18458683-18458705 AGCAAAGATTTGCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 190
1093378319_1093378324 10 Left 1093378319 12:18458650-18458672 CCAACTAATCACTAGAGCCCTTG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1093378324 12:18458683-18458705 AGCAAAGATTTGCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 190
1093378318_1093378324 11 Left 1093378318 12:18458649-18458671 CCCAACTAATCACTAGAGCCCTT 0: 1
1: 0
2: 3
3: 49
4: 271
Right 1093378324 12:18458683-18458705 AGCAAAGATTTGCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 190
1093378320_1093378324 -7 Left 1093378320 12:18458667-18458689 CCCTTGAGCCCTTATAAGCAAAG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1093378324 12:18458683-18458705 AGCAAAGATTTGCCTCCAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093378324 Original CRISPR AGCAAAGATTTGCCTCCAGC TGG Intronic
900537005 1:3183693-3183715 AGCGCTGATTTTCCTCCAGCGGG + Intronic
901229673 1:7634727-7634749 AGCAGAGTTAAGCCTCCAGCGGG - Intronic
901873394 1:12151880-12151902 AGCAGAGACCTGCCTCCATCTGG - Intergenic
902203826 1:14852899-14852921 AGCACAGATTTGGATTCAGCAGG - Intronic
902254930 1:15182253-15182275 AGCAGGGATTTGACTCCAGAAGG - Intronic
902656682 1:17873870-17873892 AGTAAAGATTTGCCACCTGTTGG - Intergenic
904524469 1:31122384-31122406 AGCTAAAATGTGTCTCCAGCAGG + Intergenic
906172125 1:43735362-43735384 AGCAAAGAAGTTTCTCCAGCTGG + Intronic
906723599 1:48027391-48027413 AGCAAAGACTCGCCTCCTCCAGG - Intergenic
911279074 1:95900658-95900680 AGAAAAGCATTGCCTGCAGCAGG + Intergenic
911980338 1:104558724-104558746 AGAAGAAATTTGCCTTCAGCTGG + Intergenic
912468846 1:109892792-109892814 AGCAGAGATTTGCCTCAGGATGG - Intergenic
915495502 1:156279877-156279899 AGCTAAGATTTGAATCCAGGCGG - Intronic
916285224 1:163098871-163098893 AGAAGAAATTTGCCTTCAGCTGG + Intergenic
916823408 1:168422401-168422423 TGCAAAGCTCTGCCTCCTGCTGG + Intergenic
917481722 1:175417837-175417859 AGCAATTATTTGCTTCCTGCTGG - Intronic
917673084 1:177292579-177292601 AGCCAAGATTTGGCACAAGCAGG - Intergenic
918562084 1:185880979-185881001 CGCAAAGATTTTGCTCCTGCTGG - Intronic
919338192 1:196267119-196267141 AGTAAAGATCTGCCTGCAGAGGG - Intronic
919421316 1:197373566-197373588 AGGAAAGATTTGTCTCCTGTTGG - Intronic
919560264 1:199109628-199109650 AGCAGAGAGTTGCCTACAGCTGG - Intergenic
920936154 1:210436929-210436951 AGCAAAGAAGTGCTTCCACCAGG - Intronic
921307846 1:213814818-213814840 AGCAAGGATTTGGATCCAGGGGG + Intergenic
922930104 1:229382245-229382267 AGCAGAGTTTTGCCTCAAGCAGG + Intergenic
924840870 1:247708522-247708544 AGAAGAAATTTGCCTTCAGCTGG - Intergenic
1063391307 10:5651426-5651448 AGCAAAGATGAACCTGCAGCAGG - Intronic
1065870070 10:29948630-29948652 AGGAAAGATTTCCCTGCAGGAGG - Intergenic
1069936245 10:71919242-71919264 AGAAAAGCATTGCCTGCAGCAGG + Intergenic
1070318529 10:75336923-75336945 AGCAGAGAGTTTTCTCCAGCTGG - Intergenic
1070611267 10:77934483-77934505 AGCAGAGAATTTCCTCCACCTGG + Intergenic
1071378294 10:85032676-85032698 AGCAGGAATTTGCCTTCAGCTGG + Intergenic
1071733377 10:88271020-88271042 AGCAAAGATTTAGCTCCAGGGGG + Intergenic
1072233665 10:93434478-93434500 AGAAAATTTTTGCCTCCAGAGGG + Intronic
1073159399 10:101376906-101376928 ATCAAAAATTTGCATACAGCAGG - Intronic
1075796033 10:125120241-125120263 ACCACAGATTAGACTCCAGCAGG + Intronic
1077006957 11:362984-363006 AGCAAAGCATTGCCACCATCTGG + Intergenic
1078308455 11:10214702-10214724 AGCAAAGCTTTGCCTTCAACAGG + Intronic
1078709932 11:13781356-13781378 ACCACAGAGTGGCCTCCAGCTGG + Intergenic
1081151810 11:39641929-39641951 GGCAAAGTTCTGCATCCAGCTGG - Intergenic
1083645156 11:64167865-64167887 AGCATAGACTTGCCAGCAGCAGG + Intergenic
1085269311 11:75260878-75260900 AGCCAAGATTTCCATCCATCCGG + Intergenic
1085484879 11:76854390-76854412 AGCAAGGATTTGAATCTAGCAGG - Intergenic
1086805863 11:91241224-91241246 TGCAAGGATTTGCAGCCAGCAGG - Intergenic
1089047862 11:115519233-115519255 AGCTCAGCTTTGCCCCCAGCAGG - Intergenic
1089178370 11:116564221-116564243 AGGATAGATGTGCCCCCAGCAGG + Intergenic
1089861302 11:121592158-121592180 AGCAAGGTTTTGCCCTCAGCAGG + Intronic
1093378324 12:18458683-18458705 AGCAAAGATTTGCCTCCAGCTGG + Intronic
1096034020 12:48447992-48448014 AGCAAAGACCAGCCCCCAGCTGG + Intergenic
1098028419 12:66230285-66230307 AGCACAGATTTACCTGCAGGAGG + Intronic
1098931638 12:76423286-76423308 ATTTAAGTTTTGCCTCCAGCAGG + Intronic
1100074101 12:90757252-90757274 AGCAAAGTTTTTCCTAAAGCTGG - Intergenic
1101264036 12:103065406-103065428 AGAAGAAATTTGCCTTCAGCTGG + Intergenic
1101536011 12:105617264-105617286 AGCAAAGTCTTGCCTGAAGCAGG + Intergenic
1103135763 12:118506205-118506227 AGGACAGATTTGCCTCCAGGAGG + Intergenic
1104941660 12:132398129-132398151 GGCCAAGACTTGCGTCCAGCAGG - Intergenic
1107097639 13:36553442-36553464 AGCAAAGAATTCCCTCCCACTGG - Intergenic
1107697033 13:43010579-43010601 AGCACAGAGTTTCCGCCAGCTGG + Intergenic
1111913153 13:94334287-94334309 AGCAAACAGTGGTCTCCAGCTGG - Intronic
1112653745 13:101426287-101426309 AGGAACTATTTGCCACCAGCAGG - Intergenic
1114407475 14:22470321-22470343 AGCACACACTTGGCTCCAGCTGG + Intergenic
1114548553 14:23520378-23520400 AGCAAAGGTGGGCCTCCAGGGGG + Intergenic
1114758349 14:25284585-25284607 AGAAGAAATTTGCCTTCAGCTGG - Intergenic
1115059614 14:29173183-29173205 AGAAGGGATTTGCCTTCAGCTGG + Intergenic
1115263008 14:31472725-31472747 AGAAAAGATTTGCCTAGAGGTGG - Intergenic
1115693401 14:35870406-35870428 AGCTTAGATTTGCTTCCATCAGG - Exonic
1116068001 14:40008473-40008495 AGAAGAAATTTGCCTTCAGCTGG + Intergenic
1116134497 14:40903887-40903909 AGCAAAGCTTTGCCTCAAGAAGG + Intergenic
1117022284 14:51583672-51583694 AGCTAGGATTTGACTCCAGGTGG + Intronic
1119350142 14:73957773-73957795 ACAAAAGATTTTCTTCCAGCTGG - Intronic
1120782741 14:88500495-88500517 AGCAAAGAATGGCCTCCATATGG + Intronic
1120973622 14:90230112-90230134 AGAAACAATTTGCCTTCAGCTGG + Intergenic
1121005246 14:90486455-90486477 AGAGAAGCTCTGCCTCCAGCAGG + Intergenic
1121567787 14:94923651-94923673 AGCGCACCTTTGCCTCCAGCAGG + Intergenic
1122592093 14:102861027-102861049 AGAAAAGCATTGCCTGCAGCAGG + Intronic
1122603719 14:102933905-102933927 AGCAAACATTTGCATCCAGCTGG - Intronic
1122665712 14:103328053-103328075 AGAGATGATTTGCCTCCAGTTGG - Intergenic
1133531745 16:6661507-6661529 AGTAAAGATTTGCCTTCTGTGGG - Intronic
1133818190 16:9214067-9214089 AGCAAAGACCAGCCCCCAGCTGG - Intergenic
1136425274 16:30165961-30165983 AAAAAAGATTTGCCCTCAGCAGG - Intergenic
1142382180 16:89739158-89739180 AGCACAGTTTCACCTCCAGCTGG - Exonic
1143607097 17:7993584-7993606 AGAAAAGATTTACCTACAACAGG + Intergenic
1144426418 17:15146605-15146627 AGAAAAGCATTGCCTGCAGCAGG - Intergenic
1144443658 17:15306865-15306887 AGCAGAGAGGTGCCTCCAGTTGG + Intronic
1146891928 17:36511855-36511877 AGCAGAGACAAGCCTCCAGCAGG - Intronic
1147045161 17:37745996-37746018 AGCAAAGCTTGACCTGCAGCTGG + Intergenic
1147719774 17:42531925-42531947 AGACAAGTTTTGCCTCCAGATGG - Intergenic
1149067306 17:52495933-52495955 AGCACAGAATTGGCTCCTGCTGG - Intergenic
1151829002 17:76538667-76538689 AGGAAGGATTTGCCTCCCCCAGG - Intronic
1155299432 18:24415758-24415780 AGCAAAAATTTGTATCCAGGAGG - Intergenic
1155327261 18:24677154-24677176 ACCCAAGATATGCCTCCAGATGG - Intergenic
1159601101 18:70429571-70429593 ATGAAACACTTGCCTCCAGCTGG + Intergenic
1161287084 19:3474189-3474211 AGCAAAGATTTGCTTGGAGACGG + Exonic
1166402694 19:42495431-42495453 AGAAAAGCATTGCCTGCAGCAGG + Intergenic
926826681 2:16912956-16912978 AGAAGAAATTTGCCTTCAGCTGG + Intergenic
928813884 2:35265346-35265368 TGAAAAGATTTGCCTTCAGTGGG - Intergenic
929315747 2:40476345-40476367 ATGAATGAATTGCCTCCAGCAGG - Intronic
930266216 2:49202471-49202493 AGCAGAGAATGCCCTCCAGCTGG - Intergenic
930910067 2:56620186-56620208 AGAAGAAATTTGCCTTCAGCTGG + Intergenic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
937104239 2:119295099-119295121 GGCAAAGGTGTGCCTCCAGGAGG + Intergenic
938688186 2:133761726-133761748 GGGCAAGATATGCCTCCAGCAGG - Intergenic
938805921 2:134807186-134807208 AGCCCAGCTTTGCCTACAGCAGG - Intergenic
940499306 2:154474722-154474744 AGAAAAGCATTGCCTGCAGCAGG + Intergenic
940606018 2:155925070-155925092 AGAAGAAATTTGCCTTCAGCTGG - Intergenic
940852187 2:158699035-158699057 AGCTAAGTTCTGCCTCCAGGAGG + Intergenic
941124518 2:161569719-161569741 AACAAAGATTTGCCTAAATCAGG - Intronic
942529843 2:176897758-176897780 AGTAAAAATTTACTTCCAGCTGG - Intergenic
942764972 2:179444212-179444234 ATCTCAGAATTGCCTCCAGCTGG + Intronic
943006806 2:182395182-182395204 AGAAGCAATTTGCCTCCAGCTGG + Intronic
946014299 2:216591657-216591679 AGCAAAGACTCTCCTGCAGCTGG + Intergenic
946498547 2:220220886-220220908 AACAAAGATCTGTCTCCAGCAGG + Intergenic
946893834 2:224302909-224302931 AGCAAAGATTTGGATGAAGCAGG + Intergenic
947535629 2:230939160-230939182 AGCTCAGCTTTGCCCCCAGCAGG + Intronic
947585993 2:231357306-231357328 AGCACTGCTCTGCCTCCAGCCGG - Intronic
947603417 2:231468376-231468398 ATCACAGATTTCTCTCCAGCAGG - Intronic
948964268 2:241364147-241364169 AGCAGGGATCTTCCTCCAGCTGG + Intronic
1168823459 20:792859-792881 AACAAAGATATCCCTCCAGATGG + Intergenic
1169580172 20:7013436-7013458 ACCAAAAATTTGACTCCTGCTGG - Intergenic
1169624661 20:7551069-7551091 ACCAAAGATGTGCCTCCTTCAGG + Intergenic
1170781554 20:19430141-19430163 AGCTAAGATTTGGCTCTTGCTGG + Intronic
1171325714 20:24290578-24290600 AGCCCAGATTTGCTTCCAGCAGG - Intergenic
1173240196 20:41288589-41288611 AGCTAAGATTTGTCTTCTGCAGG - Intronic
1174185956 20:48706529-48706551 AGAAAAGGTTTTCCTCCACCAGG + Intronic
1174257357 20:49267282-49267304 ATCAAAGATTTCACTACAGCAGG + Intronic
1175024132 20:55883296-55883318 AGCAAGGATGTGGTTCCAGCAGG - Intergenic
1175538247 20:59730301-59730323 AGAAAAGTGTTGCCTCCAGAGGG + Intronic
1175642775 20:60644811-60644833 GGCAAAGCATTGCCTCCAACTGG + Intergenic
1177188368 21:17822169-17822191 AGCAAACACTGGTCTCCAGCTGG + Intergenic
1181237484 22:21456440-21456462 AACAATGAGTTGCCTCCTGCAGG + Intergenic
1181587523 22:23861729-23861751 AGTAAGGCTCTGCCTCCAGCAGG - Intronic
1184826466 22:46955897-46955919 TGCAAACATTTGCCTCCACAGGG - Intronic
949170127 3:987307-987329 AGAAGAAATTTGCCTTCAGCTGG - Intergenic
950003801 3:9678285-9678307 TTCAAAGATTTGCATCCACCAGG + Intronic
950325584 3:12106276-12106298 AGCAGAGAGTTTTCTCCAGCTGG - Intronic
953133817 3:40165913-40165935 GGCAAAGATTTGAATCCAGCTGG - Intronic
953479613 3:43239503-43239525 ATCAAAGCTTTACCTGCAGCAGG - Intergenic
954468523 3:50673027-50673049 AGCACACATTGGCCTTCAGCAGG - Intergenic
955086720 3:55709800-55709822 AGCACAGTTTTGACTCCAGGAGG + Intronic
956003567 3:64754431-64754453 AGCAGAGAGTTTTCTCCAGCCGG - Intergenic
957044553 3:75363750-75363772 AGCTCAGATTTGCCGACAGCAGG - Intergenic
961158783 3:124704288-124704310 AGCAAACACATGCCTCCAGGAGG - Intronic
965586014 3:170319097-170319119 AGGAAAGTATTGCCTGCAGCAGG + Intergenic
966567970 3:181404170-181404192 AGAAAAGACGTGCCTCAAGCAGG - Intergenic
967831677 3:193925282-193925304 AGAAGCAATTTGCCTCCAGCTGG + Intergenic
970429614 4:15976825-15976847 AGGAATGACTTGCCTCCAGCTGG + Intronic
971892098 4:32538010-32538032 AGCAATGAGTTTTCTCCAGCTGG - Intergenic
974262463 4:59542985-59543007 AGAAACAATTTGCCTTCAGCTGG - Intergenic
975525661 4:75347023-75347045 ACCAAAGATTTAACTCCAGAAGG - Intergenic
976094268 4:81490758-81490780 AGCCAAGATTTGGACCCAGCTGG + Intronic
976473016 4:85451617-85451639 AACACAGTTTAGCCTCCAGCTGG - Intergenic
978236289 4:106465024-106465046 AGCAACCACTTGGCTCCAGCAGG + Intergenic
978294616 4:107190326-107190348 ATGAAAGACTAGCCTCCAGCAGG - Intronic
979269447 4:118742907-118742929 AGAAAATATGTGCCTCCTGCAGG - Intronic
979605914 4:122638897-122638919 ATCAAAGAGCTGGCTCCAGCTGG + Intergenic
982945048 4:161611606-161611628 ACCAATGAGTTGCCTCCATCAGG + Intronic
983834684 4:172372956-172372978 AGCCCAGCTTTGCCTGCAGCAGG - Intronic
985048844 4:185970030-185970052 AGCACAGAGTTGGCTCCTGCTGG - Intergenic
985610198 5:883653-883675 AGAAAGGATTAGCCTGCAGCAGG + Intronic
993595456 5:89849212-89849234 AGCAAACATTTTCCTCCACTGGG + Intergenic
994103367 5:95918538-95918560 AGCAAAGTTGTGTTTCCAGCAGG - Intronic
995180163 5:109223647-109223669 AGCTAAGCTGTGCCTCCTGCTGG - Intergenic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
999839775 5:155412762-155412784 AGCAAAGTTTTCCCTACACCTGG + Intergenic
1000416887 5:160993190-160993212 AGAAACAATTTGCCTTCAGCTGG + Intergenic
1003562734 6:7196158-7196180 AGCCCAGATCTGCCTCAAGCAGG - Intronic
1007422910 6:41730271-41730293 AGCAAATCTTTCCCTCCATCAGG - Intronic
1009197739 6:60707388-60707410 AGTAAAGAATTTCCTGCAGCAGG + Intergenic
1014534289 6:122597343-122597365 AGAAGTGATTTGCCTTCAGCTGG - Intronic
1015499598 6:133918747-133918769 AGCACAGATTTGCCTGAGGCTGG - Intergenic
1015585261 6:134769843-134769865 AACAAAGATGTGCATCCACCAGG - Intergenic
1017977204 6:159368769-159368791 AGAAACAATTTGCCTTCAGCTGG - Intergenic
1018861189 6:167712078-167712100 AGCAGAGATGTGCTTCCAGGAGG + Intergenic
1020026924 7:4905786-4905808 ACCAAATATTTCCCACCAGCTGG - Intergenic
1024694968 7:51846558-51846580 AGCAAAGATTGGGCTCCTTCAGG - Intergenic
1026541254 7:71281912-71281934 AGAAGAGAATTGTCTCCAGCAGG - Intronic
1029078333 7:97953205-97953227 AGCTCAGATCTGCCTACAGCAGG - Intergenic
1029689738 7:102173405-102173427 AGAAAAGATTTGCATTGAGCAGG + Intronic
1033509614 7:142046440-142046462 AGCCAAGAATTGCTTCCAACTGG + Intronic
1035260543 7:157659108-157659130 AGAAAACATTTCCCTCCACCTGG + Intronic
1035785386 8:2255745-2255767 TACAAAGATATGGCTCCAGCAGG - Intergenic
1035807422 8:2465971-2465993 TACAAAGATATGGCTCCAGCAGG + Intergenic
1037485689 8:19344496-19344518 AGCAAAGAACTTTCTCCAGCTGG - Intronic
1039331382 8:36541299-36541321 AGCAAAAAATTACCTCTAGCTGG + Intergenic
1041228937 8:55730010-55730032 AGAAAAGCATTGCCTGCAGCAGG + Intronic
1048268297 8:133006645-133006667 AGCAAGGATATGCCTCCACGAGG - Intronic
1048774182 8:137926942-137926964 AGGAAACATTTGGCTTCAGCTGG - Intergenic
1052368556 9:27640121-27640143 AGAAACAATTTGCCTTCAGCTGG + Intergenic
1052378363 9:27742381-27742403 AGCAAAGATGTCCCTCCCCCTGG + Intergenic
1056194597 9:84217292-84217314 TCCAAAGACTTGACTCCAGCTGG - Intergenic
1056314331 9:85373659-85373681 AGAAACAATTTGCCTTCAGCTGG - Intergenic
1057163499 9:92908111-92908133 AGAAAAGCATTGCCTACAGCAGG + Intergenic
1058355961 9:104083742-104083764 AGAAAAGCATTGCCTGCAGCAGG + Intergenic
1062009955 9:134261604-134261626 AGCGAAGATCTGCCTCCTGGAGG + Intergenic
1189602307 X:42640269-42640291 AGCACAAACTTGCCTCCAGCTGG + Intergenic
1189800211 X:44684949-44684971 AGCAAAGAACTTTCTCCAGCTGG + Intergenic
1191634353 X:63360021-63360043 AGGATAGATTTGCCCCCAGTGGG - Intergenic
1193291585 X:79779368-79779390 AGCTAAGATTTGACTCAAGCTGG + Intergenic
1196157738 X:112449412-112449434 AGAAAATATTTGGCTCCAACAGG - Intergenic
1196317282 X:114242914-114242936 AGATAAGATTTGTCTCCAGGAGG + Intergenic
1197477451 X:126942044-126942066 AGAAGAAATTTGCCTTCAGCTGG - Intergenic
1198171437 X:134109227-134109249 AGAAAACATTCACCTCCAGCTGG + Intergenic
1198182109 X:134220284-134220306 AGAAAAGCATTGCCTGCAGCGGG + Intergenic
1199520025 X:148724906-148724928 AGCCAAGTTTTGCTTCCAGTAGG + Intronic
1200880598 Y:8208170-8208192 GGCACAGCTTTGCCTACAGCAGG - Intergenic