ID: 1093380367

View in Genome Browser
Species Human (GRCh38)
Location 12:18483979-18484001
Sequence ATGCTGTTCTCCAGGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093380361_1093380367 9 Left 1093380361 12:18483947-18483969 CCAGGACTAAAGGAACAGCCTCC 0: 1
1: 0
2: 0
3: 30
4: 253
Right 1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG 0: 1
1: 0
2: 1
3: 31
4: 270
1093380364_1093380367 -9 Left 1093380364 12:18483965-18483987 CCTCCTACTGGGACATGCTGTTC 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG 0: 1
1: 0
2: 1
3: 31
4: 270
1093380358_1093380367 27 Left 1093380358 12:18483929-18483951 CCACATTGTCTTCTCATTCCAGG 0: 1
1: 0
2: 1
3: 27
4: 293
Right 1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG 0: 1
1: 0
2: 1
3: 31
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093380367 Original CRISPR ATGCTGTTCTCCAGGAAGAA AGG Intronic
900073538 1:793136-793158 ATGGGATCCTCCAGGAAGAAAGG - Intergenic
900555180 1:3276745-3276767 GCGCTGTTCTCCAGGGAGAAAGG - Intronic
902107854 1:14052678-14052700 TTGCTGCTCTCCAGGATGATTGG - Intergenic
902837292 1:19055105-19055127 ATGTTGTTCTCCAGGGAGCCTGG + Intergenic
907623285 1:56004053-56004075 ATCCTGTTTTCCAGGGAGAAAGG + Intergenic
909618898 1:77645456-77645478 ATGGTGATCTCCAGGGAGCAGGG + Intronic
910361999 1:86422267-86422289 ATGGTGCTCTCCTTGAAGAATGG - Intergenic
910507512 1:87966830-87966852 ATGCTGATCTCCTGCAAGAAGGG + Intergenic
911094025 1:94041279-94041301 AAGCAGTTCTTCAGGAAGAGTGG + Exonic
912243342 1:107935381-107935403 ATATAATTCTCCAGGAAGAAAGG + Intronic
913105058 1:115606605-115606627 ATGATGATCTCCAGGGAGCAGGG + Intergenic
913159196 1:116129955-116129977 AGGCTGTTCTCCTGGATGGAGGG + Intronic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
915233430 1:154463262-154463284 ATGGAGTTCTCCTGTAAGAAAGG - Intronic
916207843 1:162332503-162332525 ATGCTGTGGTCCAGGCAGAGAGG + Intronic
916678683 1:167085413-167085435 ATGCTGGTCACCAGGAAGCCTGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917932472 1:179832602-179832624 ATGCTGCCCACCAGGAAGTAAGG + Intergenic
918409248 1:184241382-184241404 ATGCCATTCTCCAAGAAGGAAGG + Intergenic
918451713 1:184664901-184664923 GTCCTGTCCTCCAGGCAGAACGG - Intergenic
919299392 1:195741172-195741194 ATGCTTATCTCCAGGAATGATGG - Intergenic
919749104 1:201025534-201025556 ATGATGATGTCCAGGCAGAAGGG + Intergenic
920600484 1:207320027-207320049 AGGCTATTCTCTATGAAGAAGGG + Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
922181282 1:223234929-223234951 ATGTTGTTCTCCTGCAATAAAGG - Intronic
922921010 1:229303445-229303467 ATGCTCTTGTTCAGAAAGAAAGG + Intronic
922949829 1:229549365-229549387 ATGATCTTCCCCAGGAAGAAAGG + Exonic
923337899 1:232985982-232986004 ATGGGGTTCTGCAGGCAGAAGGG + Intronic
923339531 1:232995834-232995856 GTGCTGTTTTATAGGAAGAAAGG + Intronic
923813697 1:237349426-237349448 ATGGGGTTCTTCAGGCAGAAAGG + Intronic
924322216 1:242861769-242861791 ATGCTGTTATCCAGCAGGACAGG - Intergenic
1065347494 10:24762989-24763011 ATATTGTTGTCTAGGAAGAAAGG + Intergenic
1067797227 10:49329400-49329422 ATTCTGTGCTTCAGGAAGACAGG - Intergenic
1067921929 10:50467952-50467974 TTCCTGTTGTCCAGGAGGAATGG + Intronic
1070698861 10:78584338-78584360 ATGTTGTTAGCCAAGAAGAAGGG + Intergenic
1071168340 10:82833333-82833355 ATTCTGCTCTCTAGGAAGATAGG + Intronic
1071775066 10:88777598-88777620 ATTCTGTTCTCCAGGTACACTGG + Intronic
1071930514 10:90464525-90464547 AAGCTGTGCTCTAGGCAGAATGG - Intergenic
1072432738 10:95387927-95387949 TTGCTGGTCTCCAGGGACAATGG + Intronic
1073304539 10:102492625-102492647 CTGCTCTTCTGCAGGAAGAGGGG + Intronic
1074393098 10:113074124-113074146 CGTCTGTGCTCCAGGAAGAAAGG - Intronic
1074686020 10:115963182-115963204 CCTCTTTTCTCCAGGAAGAATGG - Intergenic
1075318444 10:121470411-121470433 ATGCGGTTCTTCCGGAAGGAAGG - Intergenic
1076136286 10:128047295-128047317 GTTCTGGTGTCCAGGAAGAAGGG + Intronic
1077165538 11:1134057-1134079 ATGCTGTGCCCCAGGAACAAGGG + Intergenic
1079012162 11:16837797-16837819 ATGATCTTCACCAGGAAAAAGGG + Intronic
1080341153 11:31266835-31266857 AAGCTGTTCTACAGGCTGAAAGG - Intronic
1089245839 11:117119063-117119085 ATGGTGTGCTCCAGGATGAGGGG + Intergenic
1089360492 11:117882920-117882942 AAGCTGTTCTCCAGACTGAATGG - Intergenic
1089653075 11:119927531-119927553 AAGCAGTTCTCTAGGAATAATGG + Intergenic
1089883800 11:121800353-121800375 ATTCTGTTCTCTAGGCAGACTGG + Intergenic
1090604718 11:128409572-128409594 ATCTTGATCTCCAGGAAGAATGG + Intergenic
1090654822 11:128835038-128835060 GGGCTGTTCTCCAGGGAGAATGG + Intergenic
1090919468 11:131195351-131195373 ATGCTGAGCTCCATGAAGATAGG - Intergenic
1091129699 11:133134994-133135016 AGGCTGTTTTCAAGAAAGAAAGG - Intronic
1091144098 11:133262272-133262294 AATCTGTTCTCCAGGATAAATGG + Intronic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093556213 12:20477397-20477419 ATGCAGTTTGCAAGGAAGAAGGG + Intronic
1093742676 12:22706338-22706360 CTTCTTTTCTCCATGAAGAAGGG + Intergenic
1094421435 12:30275289-30275311 ATGCCCTTGCCCAGGAAGAAGGG + Intergenic
1095178584 12:39121658-39121680 TTGGTGTTCCCAAGGAAGAAGGG - Intergenic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1100235468 12:92656305-92656327 ATTCTCTTCTCCAGGAAGCGTGG - Intergenic
1102109581 12:110354820-110354842 ATGCCATTCTCCAGTAAAAAAGG + Intergenic
1102876619 12:116454151-116454173 AACGTGTTCTCCAGGAAGTAGGG + Intergenic
1104733698 12:131122977-131122999 ATTCTGTCCTCCAGGAATGATGG - Intronic
1106252049 13:27989440-27989462 CTGATGTCCTCCAGGAAGACCGG - Intergenic
1106887835 13:34208984-34209006 ATGCTGTTCTCAAGGCAGATTGG - Intergenic
1109241293 13:59892452-59892474 AAGCATTTCTTCAGGAAGAAAGG + Intronic
1110634594 13:77751794-77751816 ATGCTGTGCTCTAGGAAGAGTGG + Intronic
1110680824 13:78309742-78309764 ATCCTGCTCTGCAGGAAGAGTGG - Intergenic
1112742386 13:102489729-102489751 ATGCTGTTCTCGTGGTAGCAAGG + Intergenic
1114876193 14:26721674-26721696 TTGCTGTTCTGTAGGAATAAAGG + Intergenic
1115352627 14:32411603-32411625 ATCTTGTTCCCCTGGAAGAAGGG - Intronic
1116647807 14:47551971-47551993 TTTCTGTTTTCCAGCAAGAAAGG + Intronic
1117084907 14:52189837-52189859 ATCTTGTTATCCAGGAAAAAGGG + Intergenic
1118109887 14:62706791-62706813 CAGCTGTTCTCCAAGAAGGAGGG + Exonic
1118194934 14:63616361-63616383 ATCCTGTCCTGCATGAAGAAAGG - Intronic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1121619107 14:95333849-95333871 GTGATGTTCTCCAGCCAGAAAGG + Intergenic
1122831489 14:104399445-104399467 AAGCTGCTCTCCGGGGAGAAGGG - Intergenic
1123186486 14:106522355-106522377 ATGTCGCTCTCCAAGAAGAAAGG + Intergenic
1123320751 15:18669113-18669135 AAGCTGCTCTCTAGAAAGAAAGG - Intergenic
1123735701 15:23180402-23180424 ATGATCTTCCCCAGGAAGAAAGG - Intergenic
1124286416 15:28403385-28403407 ATGATCTTCCCCAGAAAGAAAGG - Intergenic
1124296287 15:28508251-28508273 ATGATCTTCCCCAGAAAGAAAGG + Intergenic
1126374381 15:47980580-47980602 TTGGTTTTCTCCAGGATGAATGG + Intergenic
1127057923 15:55151417-55151439 ATGCAGTTCTCCAGGCACATAGG + Intergenic
1128418957 15:67473411-67473433 ATGCTGTCCTCCAGCAGGCAAGG + Intronic
1128910294 15:71507710-71507732 AAGCTTTTCTCCAGGCACAAAGG - Intronic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1131293571 15:91128246-91128268 AGGCTGTTCTCCAAGAAGGTGGG + Intronic
1132092414 15:98957107-98957129 CTGATGATCTCCAGGAAGGAAGG - Exonic
1133229344 16:4359321-4359343 CTGTTGCACTCCAGGAAGAAAGG + Exonic
1134875701 16:17696742-17696764 ATGCCTTCCTCCAGCAAGAATGG + Intergenic
1135920977 16:26648802-26648824 ATGCTCGTTTCCAGGAAGACTGG + Intergenic
1138453547 16:57107582-57107604 CTGCTGTCCTCCAGGCAGGAAGG - Intronic
1139731392 16:68948807-68948829 ATGATTGTCTGCAGGAAGAAGGG - Intronic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1141478760 16:84292329-84292351 ACCCTGTTCTCCAGGCAGAGCGG - Intergenic
1142865664 17:2790073-2790095 ATGCTGGTCTCCAGGGAAACAGG - Intronic
1142877525 17:2860998-2861020 ATGGTGATCACCAGGAGGAAAGG - Intronic
1143162809 17:4882332-4882354 ATGCTGATTTCCAGGAAGACTGG + Intronic
1143994529 17:10995194-10995216 AGGCTTTTCTCAAGGAAGGATGG + Intergenic
1144380517 17:14692663-14692685 AAGCTGTTCTTCAGAAATAAAGG - Intergenic
1148530389 17:48384717-48384739 ATTCTGTTGTCAAGGAAGAAGGG + Intronic
1148694041 17:49548515-49548537 AACCTGTTCTTCAGGAAGCAAGG - Intergenic
1148777353 17:50103096-50103118 ATGTTCTTCTCCAGGGAGACAGG + Intronic
1149580784 17:57749011-57749033 GTTCTGTTCTCAAGCAAGAAAGG + Intergenic
1151896369 17:76983330-76983352 CTGCTCTTCCCCAGGAAGCAGGG - Intergenic
1152647492 17:81476228-81476250 CTGCTGTGCTCCAGGAAGATGGG + Intergenic
1152829839 17:82490424-82490446 ATGCAGTTATCCAGCAAGACAGG - Exonic
1153988905 18:10377701-10377723 ATACCCTTCCCCAGGAAGAAAGG - Intergenic
1155332909 18:24736241-24736263 ATGCTGAGCTTCAGCAAGAATGG - Intergenic
1156147550 18:34203756-34203778 ATGCTGCTTTCTAGGCAGAAAGG - Intronic
1156649000 18:39202110-39202132 CTGCTGGCCTCCAGGAAGCAGGG - Intergenic
1156670256 18:39460324-39460346 ATGGTTTGCTCCAGAAAGAAGGG - Intergenic
1159616506 18:70586136-70586158 AAGCTGTCCTTCAGAAAGAAAGG + Intergenic
1160237247 18:77095673-77095695 CTGCTGTTCTCCAGGGAGGATGG + Intronic
1160390193 18:78524075-78524097 ATGCTGAACTCCAGCCAGAATGG - Intergenic
1160510154 18:79448953-79448975 ATGCTGTTCTCCGGCAGGAGTGG - Exonic
1161220245 19:3115044-3115066 ATGATGTTCTCCAGGTCGAAAGG - Exonic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1162180557 19:8865944-8865966 ATGCTGCTCTTCTGGAACAAGGG + Exonic
1162909346 19:13841033-13841055 ATTCTGTCCTCCATGAATAACGG - Intergenic
1163823880 19:19512001-19512023 AGGTTGTTCCCCAGGAAGAGGGG - Intergenic
1165470764 19:36003218-36003240 ATTCTGTTCTCAAGGCAAAAGGG + Intergenic
1166237540 19:41467399-41467421 CTGCTAGTATCCAGGAAGAAAGG - Intergenic
1168352827 19:55686377-55686399 CTTCTGCTCTCCAGGAAGAGTGG + Intronic
1168625619 19:57915706-57915728 AGGCTGTTCTCCAGGCAAGAAGG - Intronic
928203768 2:29269475-29269497 CAGCTGTGCTCCAGGAAGAGAGG - Intronic
930670809 2:54148261-54148283 ATTCTCTTGGCCAGGAAGAAGGG + Intronic
931226848 2:60339219-60339241 AAGCTGTCATCTAGGAAGAAAGG + Intergenic
931736338 2:65198284-65198306 ATGCTGTTTTCCCAGAAAAATGG - Intergenic
933416543 2:81993890-81993912 AGGCTGCTCTCCAGGCAAAAGGG - Intergenic
933476010 2:82791045-82791067 ATTCTGTTCTCCAGGAAAATAGG - Intergenic
933675018 2:85047481-85047503 AAGCTCTTCTCATGGAAGAAAGG + Intronic
933877408 2:86632916-86632938 ATGGTTTACTCCAGGAGGAATGG - Intronic
934515186 2:94981882-94981904 ATGCTGTACTCCAGGGACACAGG + Intergenic
935147997 2:100409343-100409365 CTTCTGTTCTCCAGGAAGCCAGG + Intronic
935350376 2:102147385-102147407 AGGCAGTGCTCCAGGGAGAAAGG + Intronic
936474477 2:112827859-112827881 AGGCTGTTCCACAGGAAGCATGG + Intergenic
939602164 2:144205572-144205594 ATTCTGTTAACAAGGAAGAAGGG + Intronic
939847624 2:147267813-147267835 ATGCTTCTTGCCAGGAAGAATGG + Intergenic
940662736 2:156567704-156567726 AAGCTGGTCTACATGAAGAAGGG + Intronic
942129774 2:172866626-172866648 GTTCTGTTCTCCAAGCAGAAGGG - Intronic
942606705 2:177699636-177699658 ATGCAGATCTGGAGGAAGAAAGG + Intronic
943025843 2:182626567-182626589 ATAATGTTCTCCAGAATGAAGGG - Intergenic
943803312 2:192089567-192089589 ATGCTGTTCTCACGAAAAAATGG - Intronic
944630777 2:201621902-201621924 ATGCATGTCTCCAGGAAGCAGGG - Exonic
946765636 2:223037449-223037471 AGACTGGTCCCCAGGAAGAAGGG + Intergenic
947499862 2:230664147-230664169 ATGCTGTTAGTAAGGAAGAAGGG + Intergenic
947854086 2:233311568-233311590 CGGCTTTTATCCAGGAAGAAGGG + Intronic
1169277125 20:4241225-4241247 ATGGTGGTTTCCAGGGAGAAAGG + Intronic
1169845037 20:9980966-9980988 ATGCTGACCTCAAGGAAGAAGGG + Intergenic
1170129476 20:13003127-13003149 ATGCTGTTCTCCAGATAGTGAGG - Intergenic
1172792778 20:37517629-37517651 ATGCTGATCTCCAGCAGGCAGGG + Exonic
1172811435 20:37650969-37650991 ATGCTGTGCTCCAGAAAAAATGG + Intergenic
1172992939 20:39049473-39049495 ATGCTGTTTCCCTGGGAGAATGG + Intergenic
1174439849 20:50541963-50541985 AGTCTATTCTACAGGAAGAAGGG - Intronic
1176066141 20:63196946-63196968 ATGCTTTTCTCCTGGTAGAGGGG - Intronic
1178698058 21:34810973-34810995 CTGCTGCTCTGCAGGAGGAAGGG - Intronic
1180214998 21:46318200-46318222 AGGCTGGTCTCCAGGAGGTAAGG - Exonic
1180990647 22:19933744-19933766 ATGCTGTTCTGTGGGAGGAAGGG + Intronic
1181534973 22:23537045-23537067 ATGCTTTTCTCTAGGGTGAAGGG + Intergenic
951267024 3:20579300-20579322 ATTCTGTTCTTCAGAAATAAAGG + Intergenic
953570339 3:44066472-44066494 CTGCTGCTGTCCAGAAAGAAGGG - Intergenic
953666167 3:44927981-44928003 ATGGTCTTCTCAGGGAAGAACGG + Intronic
954447231 3:50553294-50553316 ATGGTGTACCCCAGGTAGAAGGG + Intergenic
955226535 3:57064760-57064782 ATGCTGGTCTCCAGGGACTAGGG + Intronic
955542381 3:59991324-59991346 AAGATCTTCTCCAGGTAGAAAGG + Intronic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
957902995 3:86521206-86521228 ATGCTGTTTTCCATTTAGAAGGG - Intergenic
958457475 3:94349511-94349533 ATCCTGTTATCAAGAAAGAAGGG + Intergenic
959479196 3:106850689-106850711 ATGCTCAGCTCCAGGAAGCAGGG + Intergenic
961170890 3:124796990-124797012 ATTCTCTTCTCCATGAAGCATGG - Intronic
963082416 3:141406541-141406563 ATGCTGTCTCCCAGGCAGAAGGG + Intronic
963122515 3:141788214-141788236 ATGTTGTTCTACAGGCAGTAGGG + Intronic
963373356 3:144430899-144430921 ATGCTGTGCTCTACAAAGAAAGG - Intergenic
966668808 3:182504314-182504336 ATACTGTTATCCAGGATGAGCGG + Intergenic
970200403 4:13599229-13599251 CTGCTGCTCAGCAGGAAGAAAGG + Exonic
971219183 4:24689426-24689448 ATTCTGAGTTCCAGGAAGAAAGG + Intergenic
971403190 4:26295215-26295237 TGGCCGTTGTCCAGGAAGAAAGG + Intronic
972189908 4:36577402-36577424 AATCTGTTCTTCAGGAATAAGGG + Intergenic
972581385 4:40398526-40398548 ATGCTGGACTCCACAAAGAATGG + Intergenic
974572583 4:63672935-63672957 ATTCTGTTCTACAGGAAGGTGGG - Intergenic
976507865 4:85870403-85870425 ATTTTGCTTTCCAGGAAGAAAGG + Intronic
976557617 4:86467490-86467512 ATGCTGTTTTCCAGGATAACAGG - Intronic
977610446 4:99024766-99024788 AGTCTGGTCTCCAGGAAGAAGGG + Intronic
978630660 4:110739988-110740010 ATGCTGTTCTACAAGTAGAGAGG - Intergenic
979084782 4:116393759-116393781 ATGCTGTTCCCTGGGAGGAAGGG + Intergenic
979588219 4:122445922-122445944 ATGCTCTTTCCCAGGAAGATGGG + Intergenic
981437675 4:144745798-144745820 ATGCATTTATCCAGGAAGAAAGG - Intergenic
981543809 4:145873490-145873512 ATGCTGTGGTCTAGGTAGAAAGG - Intronic
984246653 4:177283039-177283061 GTTCTATTATCCAGGAAGAAGGG - Intergenic
984871391 4:184328532-184328554 ATACTGTTCTCTAGGAACAGCGG - Intergenic
984970212 4:185181802-185181824 CTGCAGTTTGCCAGGAAGAAAGG + Intronic
985881642 5:2642865-2642887 GTGCTGTCCTCCAGGACGAGGGG + Intergenic
987095681 5:14547077-14547099 AGGCATTCCTCCAGGAAGAAGGG - Intergenic
988037813 5:25850929-25850951 ATGCTGTTCTCATACAAGAAAGG - Intergenic
989580702 5:43030508-43030530 AAGCTTTTCTCCTGGTAGAAAGG + Intergenic
994410588 5:99402938-99402960 ATGCTGTTCACAAGGATGGATGG + Intergenic
994483244 5:100362331-100362353 ATGCTGTTCACAAGGATGGATGG - Intergenic
994963560 5:106637301-106637323 ATACATTTCTCCAGGAATAATGG - Intergenic
996401777 5:123070429-123070451 ATGCAGTTCTCTAGGGAGAATGG + Intergenic
996802863 5:127422652-127422674 ATGCTGTTTTCCATGCAGGATGG + Exonic
997978125 5:138452197-138452219 GTTTTGTTCTCCCGGAAGAAGGG + Intergenic
998753442 5:145350764-145350786 TTCCTGTGCTCCAGGAAGGAAGG + Intergenic
999087897 5:148909852-148909874 TAGCTGTGCTCCAGGAAGAGAGG + Intergenic
999435739 5:151562048-151562070 ATGCTTTTCTCCTGGAAAACAGG - Intronic
999956919 5:156712766-156712788 ATGCTGCTCTGAAGGAAGAGGGG - Intronic
1000256969 5:159548641-159548663 ATGCAGTTCTCAGGGAAGAGGGG + Intergenic
1002445972 5:179290190-179290212 ATACTGTTCTCAAGGTAGCAAGG + Intronic
1002660336 5:180787244-180787266 AGGCTGGTCTCCAGGAAATAGGG + Intergenic
1002681834 5:180970686-180970708 ATTCTGTTCACCAGGGAGGACGG - Intergenic
1004004584 6:11627266-11627288 ATTCTGTTAGCCAGGAACAAGGG + Intergenic
1004202188 6:13559122-13559144 ATGCTGTTCTCAGAGAAAAAGGG - Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006277826 6:33020265-33020287 ACGCTGTGCTCCAGAAAGACTGG - Intergenic
1006696562 6:35935517-35935539 TTGCTGTTCTCCTGTAAGTATGG + Intergenic
1007253278 6:40510964-40510986 ATCCTGTTTTGCAAGAAGAAAGG + Intronic
1008146367 6:47896431-47896453 TTGCTGTTTTCCATGAAGAAGGG + Intronic
1008762100 6:54863423-54863445 ATGGTGCTCACCAGGAAAAAGGG - Intronic
1008788781 6:55203457-55203479 AAGGTGATCTCCAGGAAGACAGG - Intronic
1009823355 6:68834378-68834400 ATGCTGTAATCCAGAAAAAATGG + Intronic
1009866374 6:69402695-69402717 ATCATGTTCTACAGAAAGAAAGG + Intergenic
1009943343 6:70315492-70315514 ATTCTGTTCTATAGGCAGAAGGG + Intergenic
1011029007 6:82900756-82900778 ATTCTGTCCAGCAGGAAGAATGG + Intronic
1013149565 6:107430988-107431010 TTGCTATTCTCCAGGTAGGAAGG + Intronic
1017242692 6:152188264-152188286 GTTATGTTCTCCAGGAAGCAGGG - Intronic
1017375854 6:153767171-153767193 TTGCTGTTTTCCAGGAACAAAGG - Intergenic
1017949772 6:159126873-159126895 ATGCTTTTCTCTAGGCAGAAAGG - Intergenic
1018249685 6:161856623-161856645 ATGATGTTCTCTGGGGAGAAGGG - Intronic
1018373626 6:163191120-163191142 AAGCTGTTCTCCTGGACTAAGGG - Intronic
1020919985 7:14251731-14251753 AGGCTGTTCTTCAGTAATAAAGG - Intronic
1022377724 7:29830019-29830041 ATGCTGAGCTCCAGGAAGTCAGG - Intronic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1023474785 7:40564973-40564995 TTCCTGTACCCCAGGAAGAATGG + Intronic
1023523262 7:41070490-41070512 ATGCTGTGCACCTGGAACAAAGG - Intergenic
1024564230 7:50668289-50668311 TTGCTGTTCTCAAGCAAGACAGG - Intronic
1026565724 7:71488332-71488354 ACGCTGTACTCCAGGCAGATGGG - Intronic
1027347650 7:77277706-77277728 ATGCTGTTCTCCATGAGAATAGG - Intronic
1029099942 7:98121140-98121162 ATGCGGTTCACCAGGGTGAACGG - Intronic
1032176711 7:129635530-129635552 ATTCTGTTCTCCCAGGAGAAGGG + Intronic
1033607613 7:142938992-142939014 ATGCTGCTCTACATGAAGCATGG - Intergenic
1033937285 7:146602924-146602946 ATGCTGTTATCTGGGAATAACGG - Intronic
1034307962 7:150061303-150061325 TTCCTGTTCTCCAAGAAGACAGG - Intergenic
1034594439 7:152176297-152176319 AGGCTGTTCTTCTAGAAGAAGGG + Exonic
1034798891 7:154039366-154039388 TTCCTGTTCTCCAAGAAGACAGG + Intronic
1034856833 7:154557760-154557782 ATGCTGTACTGCAGCACGAAGGG + Intronic
1035542117 8:448450-448472 ATGGGATCCTCCAGGAAGAAAGG + Intronic
1036117167 8:5971141-5971163 ATGCTGTTCTCCTGGTAGCGAGG - Intergenic
1036972472 8:13370176-13370198 ATGATATGCTCTAGGAAGAATGG - Intronic
1037827683 8:22168850-22168872 GTGGGGTTCCCCAGGAAGAAGGG + Intronic
1039270835 8:35878443-35878465 ATGTTGTTCTCTAAAAAGAATGG + Intergenic
1040487201 8:47884846-47884868 ATACTGATCTCCAGGGAGAAAGG + Intronic
1040503133 8:48022735-48022757 AAGCTGTTCTTCAGAAACAAAGG - Intronic
1040562532 8:48536767-48536789 AGGCTGTTCTCCATGTAGCAAGG - Intergenic
1040627052 8:49161041-49161063 CAGCTGGTCTCCAAGAAGAATGG + Intergenic
1040850480 8:51896602-51896624 ATGCTGTTAACCAAGAAGATGGG - Intronic
1041381244 8:57256502-57256524 ATGCTGGTCTTCAGGTAGAGTGG + Intergenic
1044420051 8:91984232-91984254 ATCATGTTCTCCAGGAAGAGAGG - Intronic
1045893617 8:107187354-107187376 AAGCTGTTTCCCAGGCAGAATGG - Intergenic
1046224867 8:111264715-111264737 ATGCTGTTCTTCCAGAAGAGAGG + Intergenic
1046673949 8:117088372-117088394 ATACTGGACTCCAGGAATAAGGG - Intronic
1048819818 8:138370279-138370301 ATGCTGTTGTTCAGGATGAATGG + Intronic
1050262249 9:3852796-3852818 ATGACTTTCTCCAGGAAGATGGG - Intronic
1051893071 9:21962831-21962853 ATGCTATACTCCTGCAAGAATGG - Intronic
1052396402 9:27943884-27943906 AGGATGTTCTCCAGGGAGAAGGG + Intergenic
1052791025 9:32875827-32875849 AAGCACTTCACCAGGAAGAAAGG + Intergenic
1058136502 9:101313564-101313586 AAACTCTTCTCCAGGAAGATAGG - Intronic
1059195506 9:112367480-112367502 ATGCTGTCCTTCAGAAATAAAGG - Intergenic
1059409550 9:114123548-114123570 TATCAGTTCTCCAGGAAGAAGGG + Intergenic
1059663554 9:116425025-116425047 AAGCTGTGCTAGAGGAAGAATGG - Intergenic
1060795377 9:126509285-126509307 ATTATGTGCTCCTGGAAGAAGGG + Intergenic
1061074534 9:128333055-128333077 TTCCAGTTCTCCAGGAAGTAAGG + Intronic
1061137130 9:128741413-128741435 CTGCCCTTCTCCAGGAAGCATGG + Intronic
1061513761 9:131076621-131076643 ATGCCCTTGTCGAGGAAGAATGG + Intronic
1061703536 9:132434561-132434583 AGGCTTTTCTCCATGAAGGAAGG + Intronic
1062416848 9:136455507-136455529 AAGCAGTTCTCCAGGAGGCAAGG + Intronic
1062720048 9:138036112-138036134 AAGCTGTTCTTCAGGCAGAAGGG - Intronic
1187715048 X:22094402-22094424 ATGAGTTTCTCCAGGAAAAACGG - Intronic
1188348313 X:29095671-29095693 ATGATTTTCTCAAGGAATAATGG + Intronic
1188674557 X:32922773-32922795 ATGCTGTTCTCCCCAAAGCAGGG - Intronic
1188966415 X:36558633-36558655 ATAATATTCTCCAGGAAGATAGG + Intergenic
1189148099 X:38675750-38675772 ATGCCATGCTCCAGGAAGTAGGG - Exonic
1189643979 X:43106441-43106463 AAGGTGCTCTCCAGGAAAAATGG - Intergenic
1191128065 X:56979013-56979035 AATCTGTTCTGCAGGCAGAAGGG - Intronic
1191576673 X:62714035-62714057 AGGCTGTTCCCCAGGGAGTAAGG + Intergenic
1191662190 X:63663490-63663512 ATCCTTTTTACCAGGAAGAAAGG - Intronic
1191669781 X:63738545-63738567 ATGCGGTGCTTCAGGAAAAATGG - Intronic
1192604013 X:72494775-72494797 ATGCTTTTCTCAAGATAGAATGG - Intronic
1192632678 X:72789433-72789455 CGTCTGTTCTCCAGGAAGAGAGG - Intronic
1192649031 X:72931368-72931390 CGTCTGTTCTCCAGGAAGAGAGG + Intronic
1194917218 X:99721303-99721325 AAGCTGTTCTTCAGTAATAAAGG + Intergenic
1195021327 X:100831702-100831724 ATTTTGTTCTCAGGGAAGAAGGG - Intronic
1198024978 X:132696061-132696083 ATGCTGGCCTCCAGGAAGCTGGG + Intronic
1198073106 X:133169048-133169070 ATGCTTTTCTCCAGGTCCAATGG - Intergenic
1198747434 X:139904559-139904581 ATGTTGTTCTACAGGTAGAGGGG + Intronic
1199594470 X:149495728-149495750 ATTCTGCTCTCCAGGGAGAAAGG + Intronic
1199655871 X:149994987-149995009 AAGTTTTTTTCCAGGAAGAAGGG - Intergenic
1200798600 Y:7364219-7364241 CTCCTCTTCACCAGGAAGAAGGG + Intergenic