ID: 1093381535

View in Genome Browser
Species Human (GRCh38)
Location 12:18500177-18500199
Sequence TCCAGCCGGCCGGCAAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 90}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093381535_1093381547 16 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381547 12:18500216-18500238 GGCTTGGCGGGCCCCGCACTCGG 0: 237
1: 383
2: 328
3: 217
4: 228
1093381535_1093381542 -5 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381542 12:18500195-18500217 CTGGAGTTCCAGGTGGGCGTGGG 0: 51
1: 495
2: 390
3: 482
4: 672
1093381535_1093381553 29 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381553 12:18500229-18500251 CCGCACTCGGAGCGGCCGGCCGG 0: 41
1: 259
2: 422
3: 397
4: 359
1093381535_1093381541 -6 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381541 12:18500194-18500216 GCTGGAGTTCCAGGTGGGCGTGG 0: 51
1: 512
2: 428
3: 518
4: 742
1093381535_1093381548 21 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381548 12:18500221-18500243 GGCGGGCCCCGCACTCGGAGCGG 0: 46
1: 135
2: 165
3: 213
4: 255
1093381535_1093381545 3 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381545 12:18500203-18500225 CCAGGTGGGCGTGGGCTTGGCGG 0: 57
1: 524
2: 520
3: 379
4: 680
1093381535_1093381546 4 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381546 12:18500204-18500226 CAGGTGGGCGTGGGCTTGGCGGG 0: 44
1: 451
2: 515
3: 433
4: 647
1093381535_1093381549 25 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381549 12:18500225-18500247 GGCCCCGCACTCGGAGCGGCCGG 0: 44
1: 353
2: 475
3: 417
4: 316
1093381535_1093381543 0 Left 1093381535 12:18500177-18500199 CCAGTGCTTGCCGGCCGGCTGGA 0: 1
1: 0
2: 3
3: 32
4: 90
Right 1093381543 12:18500200-18500222 GTTCCAGGTGGGCGTGGGCTTGG 0: 92
1: 754
2: 595
3: 338
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093381535 Original CRISPR TCCAGCCGGCCGGCAAGCAC TGG (reversed) Intronic
905824966 1:41020458-41020480 CGCAGCAGGCAGGCAAGCACCGG + Exonic
911001446 1:93170364-93170386 GCCGGCCGGCCTGCAAGCCCTGG + Intronic
915165595 1:153946305-153946327 GCCGGCCGGCCGGGAAGCGCGGG - Exonic
922152344 1:223017125-223017147 GCCACCCGGCCGGCCAGCACTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG + Intergenic
1071721353 10:88149751-88149773 TGCAGCAGGAAGGCAAGCACCGG + Intergenic
1081694863 11:45102716-45102738 TCCACCAGGGCGGCCAGCACAGG - Intronic
1081813731 11:45927424-45927446 TCCTGCCGGGCAGCAAGCACTGG - Exonic
1084259110 11:67963300-67963322 TCCAGCCGGCAGGCAAGTGCTGG - Intergenic
1084569062 11:69948830-69948852 TCCAGGAGGCCGGGCAGCACAGG - Intergenic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096121085 12:49089904-49089926 TCCAGCCGACTGGCATGCATTGG - Exonic
1096260117 12:50085258-50085280 CCCGGCCGGCCGGCCGGCACGGG - Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1102460567 12:113097250-113097272 TCCAGCCTGGGGGCAAGTACAGG - Exonic
1102887790 12:116534553-116534575 TCCTGCGGGCCGGCCAGCATTGG - Intergenic
1104039212 12:125118628-125118650 TCCAGCCGACCTGCAAAGACAGG - Exonic
1104884802 12:132100502-132100524 TCCTGCCGGCCGGCCCGCCCAGG + Intronic
1104934140 12:132355515-132355537 ACCAGCCAGCCGGCCAGGACAGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116849425 14:49893344-49893366 GCCCGCCGGCCTGCGAGCACTGG - Exonic
1119303685 14:73590698-73590720 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1123417236 15:20102814-20102836 CCCAGCCAGCCAGCCAGCACAGG - Intergenic
1123417247 15:20102874-20102896 CCCAGCCAGCCAGCCAGCACAGG - Intergenic
1123417440 15:20103693-20103715 CCCAGCCAGCCAGCCAGCACAGG - Intergenic
1123417451 15:20103753-20103775 CCCAGCCAGCCAGCCAGCACAGG - Intergenic
1123526512 15:21109668-21109690 CCCAGCCAGCCAGCCAGCACAGG - Intergenic
1123526523 15:21109728-21109750 CCCAGCCAGCCAGCCAGCACAGG - Intergenic
1123526816 15:21110971-21110993 CCCAGCCAGCCAGCCAGCACAGG - Intergenic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1132653190 16:1030757-1030779 TCCAGCCGGCCCACACCCACTGG - Intergenic
1132700491 16:1220170-1220192 TCCAGCCGGCCGGCGGCCCCAGG + Exonic
1139649509 16:68355315-68355337 CCCAGCCTGCCGCCAGGCACCGG + Intronic
1139656154 16:68388285-68388307 TCCAGCCTGCCGGGAAGCAGAGG + Intronic
1141619665 16:85230270-85230292 TCCAACCGGCAGGCAAGGACAGG + Intergenic
1141959096 16:87392582-87392604 CCCCGCCGGCCGGCAGCCACCGG - Intronic
1145002218 17:19313302-19313324 CCCATCCAGCAGGCAAGCACGGG - Intronic
1148023364 17:44568314-44568336 GCCAGCCAGCCCGCAAGCCCCGG + Intergenic
1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG + Intergenic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1160659023 19:289841-289863 TCCACCCGGCCGGCAACTGCAGG - Intronic
1163233946 19:16020419-16020441 GCCAGCTGGCAGGGAAGCACCGG + Intergenic
925370632 2:3342699-3342721 TCCAGCCAGCGAGCACGCACAGG + Intronic
925413431 2:3653416-3653438 TCCAGGTGACCGGCAAGGACTGG + Intergenic
926320509 2:11745984-11746006 TCCAGCCGGGAGGCAGGCAGCGG - Intronic
927215961 2:20667873-20667895 ACCAGCCGGCCTGCAAGGCCAGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
933060846 2:77735002-77735024 GCCGGCCGGCCCGCAAGCCCTGG - Intergenic
933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG + Intergenic
937980044 2:127609415-127609437 TCCAGCAGGCCGGGCAGCACGGG - Intronic
938904703 2:135826833-135826855 GTCAGCCAGCCCGCAAGCACAGG + Intronic
941178861 2:162234890-162234912 TCTAGCTGGCCGGCAAGCGTGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
944482793 2:200174880-200174902 GCCGGCCGGCCGGCAAGCCCGGG + Intergenic
945025373 2:205615399-205615421 TCCAGCCGGACGGCCAGCTTAGG + Intronic
945401382 2:209387476-209387498 GCCAGCCGGCCGGCAAGCCCCGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948502296 2:238404674-238404696 CCCTGCCGGCTGACAAGCACCGG - Intergenic
1175272725 20:57746350-57746372 TTCACCCGGCTGGCATGCACAGG - Intergenic
1175460672 20:59149831-59149853 TCCAGCTGGCCGGTGTGCACAGG + Intergenic
1175913109 20:62413962-62413984 CCAAGCCGGCCGGCCAGCATGGG - Exonic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1182338038 22:29598285-29598307 GCCGGCCCGCCGGCAAGCCCCGG - Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950045429 3:9946266-9946288 TCCAGCCGCGCGGCAAGCCTGGG - Exonic
950068959 3:10136655-10136677 CTCAGCCGGCCTGCAAGCCCAGG - Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953326187 3:42013973-42013995 TGCAGCCGGCCGGGCGGCACGGG - Intronic
957074055 3:75587830-75587852 TCCAGCTGGCAGGGAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961455661 3:127022694-127022716 TCCAGCTGTCCAGCAGGCACAGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964130498 3:153281378-153281400 TCCAGCCTCCAGGCGAGCACAGG - Intergenic
964375043 3:156041416-156041438 GCCAGCCGGCCTGCAAGCCCCGG + Intronic
968427066 4:531271-531293 TCCAGCCTCCCGGCAACCTCAGG + Intronic
968427083 4:531333-531355 TCCAGCCTCCCGGCAACCTCAGG + Intronic
968495013 4:910576-910598 TCCCGCAGGCCGGCTAGCGCAGG - Intronic
969259258 4:6023213-6023235 TCTTTCCGGCCGGGAAGCACAGG - Intergenic
969889810 4:10249428-10249450 TGCAGGCGGCCTGCAAGAACAGG - Intergenic
973764339 4:54149628-54149650 TCGCGCTGGCCGGCGAGCACGGG + Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
980827332 4:138088828-138088850 GCCGGCCAGCCCGCAAGCACCGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986253090 5:6079090-6079112 TCCGGCAGGCTGGGAAGCACGGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
991054427 5:62306272-62306294 TCCTGCCGGCCTGCAGGCCCGGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995112385 5:108442301-108442323 GCCAGCCGGCCCGCAAGCCCCGG - Intergenic
1002697407 5:181100201-181100223 TCCAGATGGCCTGCAAGCCCTGG - Intergenic
1003836219 6:10074928-10074950 GCCGGCCGGCAGGCAAGCCCCGG - Intronic
1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG + Intergenic
1004338227 6:14783826-14783848 GCCGGCCGGCCCGCAAGCCCCGG - Intergenic
1006386146 6:33732143-33732165 GCCAGGCTGCCGGCCAGCACTGG - Intronic
1006472969 6:34238279-34238301 TCCCGCCGGCCGGCCTGCAACGG + Intronic
1006940425 6:37748411-37748433 TCCTGCCAGCCTGCAAGCCCTGG - Intergenic
1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG + Intronic
1014967123 6:127769049-127769071 TCCAGCCAGCCAGCTAGCAAAGG - Intronic
1020055722 7:5116701-5116723 TGCAGCCGGCGGGGAAGGACTGG - Intergenic
1021533828 7:21680139-21680161 TCCAGCCGCACGGCAATCTCAGG + Intronic
1023396236 7:39754267-39754289 TCTAGCTGGCCTGCAAGCCCCGG + Intergenic
1027778947 7:82499711-82499733 ACCGGCCGGCCCGCAAGCCCCGG + Intergenic
1034420659 7:150988973-150988995 TCCTGCCTGCTGGCAAGGACGGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1044411541 8:91889639-91889661 CCGAGCCAGCCGGCAAGAACAGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1049256764 8:141618334-141618356 TCCAGCCAGAAGGCAAGCAGAGG - Intergenic
1049410555 8:142472050-142472072 TCCAGCAGGTCGGGCAGCACCGG - Intronic
1051419721 9:16877316-16877338 GCCAGCAGGCCAGCAAGCCCCGG - Intergenic
1057486225 9:95486639-95486661 TCCAGCAAGCTGGCCAGCACGGG + Intronic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1196811082 X:119629504-119629526 TGCAGCTGGCAGGGAAGCACAGG + Exonic
1196874440 X:120144620-120144642 TCCTGCCGGCCGGCAAGGCCGGG - Intergenic
1201161220 Y:11168681-11168703 GCCAGCAGGCCGGCTGGCACGGG + Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic