ID: 1093385231

View in Genome Browser
Species Human (GRCh38)
Location 12:18544987-18545009
Sequence TTGTGGTTATGTATGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093385231 Original CRISPR TTGTGGTTATGTATGGAAAA TGG (reversed) Intronic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901618285 1:10559814-10559836 TTGTGGTAAAGGATGGAACAGGG + Intronic
904579244 1:31528241-31528263 TTGTGCTTCTGTATCCAAAATGG + Intergenic
904949593 1:34225733-34225755 TTTTGGTAATGTCTGGACAATGG - Intergenic
905603455 1:39273967-39273989 TTGTGGTTATGTTTTAAAAAAGG + Intronic
906304054 1:44705162-44705184 ATGAGGTGATGTATGGAAAGTGG - Intronic
907558329 1:55364972-55364994 TTGTGGTGATGTATCAAAAAGGG + Intergenic
908017746 1:59862365-59862387 TTGTGGAAATGATTGGAAAATGG + Intronic
908856319 1:68433680-68433702 TTGTGGTCATGCATCTAAAATGG + Intronic
909125435 1:71662367-71662389 AAGTGGTTATGCATGGAGAACGG + Intronic
909137978 1:71825716-71825738 ATGTGATTATGCATGTAAAATGG + Intronic
909362085 1:74773075-74773097 TTGTGATTGTGTAAGTAAAATGG + Intergenic
909699480 1:78506130-78506152 TTGCTGTTAGGAATGGAAAATGG - Intronic
909719549 1:78751926-78751948 TTGTGTTTGTTTATAGAAAAGGG - Intergenic
909942158 1:81623534-81623556 ATGTGGTTATATTTGGAAATAGG + Intronic
910545837 1:88416997-88417019 TTGTGGTTTTGGATCTAAAATGG - Intergenic
911296461 1:96123064-96123086 TTGTGGTTGAGTATGAAAAACGG - Intergenic
911787190 1:101965876-101965898 TTTTGGTTATATTTGGTAAATGG + Intronic
912980104 1:114363684-114363706 TTGGGGCCATGTTTGGAAAATGG - Intergenic
914416537 1:147488529-147488551 TTGTGGTCATTAATTGAAAATGG + Intergenic
914986059 1:152458041-152458063 TTGTTGTTTTGTAGGTAAAATGG + Intergenic
915112106 1:153570613-153570635 GTGTTGTTATGTGTGGCAAAGGG - Intergenic
915819684 1:159008917-159008939 ATGTGGTCATGAGTGGAAAAGGG - Intronic
916659267 1:166906294-166906316 TTGTGTTTATGCATTGAACATGG + Intergenic
916950419 1:169774817-169774839 TTTTGGTTATTTGTGGGAAAAGG - Intronic
916991059 1:170245930-170245952 TGGTGGGAATGTATGAAAAACGG + Intergenic
917266301 1:173224205-173224227 TTGTGTTTGTGCATGGAATAGGG - Intergenic
917516965 1:175716248-175716270 TTTAGGTTAAGAATGGAAAATGG - Intronic
918651292 1:186966447-186966469 TTATCATTAGGTATGGAAAAAGG + Intronic
918885270 1:190184935-190184957 TTATGTTTATGTATGGAATATGG - Intronic
919688950 1:200511404-200511426 TTGAGGTTAGGTGTGGACAAGGG + Intergenic
920830057 1:209456425-209456447 ATGTGGTTTGGTATGGAACATGG - Intergenic
921557907 1:216621430-216621452 TTGTTGCTAGGTAAGGAAAAAGG + Intronic
922310009 1:224379728-224379750 TTGTTCTAATATATGGAAAAGGG + Intergenic
923012766 1:230101920-230101942 TTGTGCTTCTGTCTGGCAAAGGG - Intronic
923055086 1:230420385-230420407 CTGTGGTTATCTCTGGGAAAAGG + Intronic
923241574 1:232090234-232090256 TTGGGGTTGGGTAGGGAAAATGG - Intergenic
923967296 1:239156103-239156125 TTGGGGTAAGGTATGGAGAAAGG + Intergenic
924245702 1:242082107-242082129 TTGTAGTTATTTATATAAAAAGG - Intergenic
1063129474 10:3165485-3165507 TTGGGATTTTGTGTGGAAAATGG + Exonic
1063406867 10:5804456-5804478 TGGTGGTTATGATTGGAATACGG - Intronic
1064566739 10:16647292-16647314 TTGTGGATAGGTATGTAAAGTGG + Intronic
1064644969 10:17451772-17451794 TTTTGGTTATTTATGGAGCAGGG - Intronic
1066824416 10:39548085-39548107 TTGTGGTTTTCTTTGGAAACGGG + Intergenic
1067177902 10:43962948-43962970 TTGTGGTTATGTAAGGAATTTGG - Intergenic
1068248072 10:54399122-54399144 ATGTGATTATGTATTCAAAATGG - Intronic
1069522034 10:69129950-69129972 TTGTGGCTATGTAGGGCACAAGG - Intronic
1070472179 10:76792146-76792168 TTGTGGTAAGGCATGGAAAGGGG - Intergenic
1071111271 10:82160162-82160184 TTGTGTTTAGGTAGGTAAAATGG - Intronic
1071737324 10:88316457-88316479 ATGTGGTACTGTATGGAAGAGGG - Intronic
1072822863 10:98575309-98575331 ATGTGGTGCTGTGTGGAAAATGG - Intronic
1073936492 10:108638919-108638941 TTGTGGTTATGTGATGATAATGG - Intergenic
1075509518 10:123059595-123059617 TTGTGTTTTTGTGTAGAAAAGGG - Intergenic
1075620471 10:123924050-123924072 TTGTGGTTATATAAGTAAAAAGG + Intronic
1076285894 10:129296184-129296206 TTTTGATAATATATGGAAAAAGG + Intergenic
1078629568 11:12989957-12989979 ATGAGGTGATGTATGTAAAAAGG - Intergenic
1078633339 11:13026622-13026644 CTGTGGTTATCTTTGGGAAATGG + Intergenic
1078925064 11:15867287-15867309 TTGTGGTTATCTTTGGGAAGGGG + Intergenic
1078925826 11:15874086-15874108 TTGTGATTTTATTTGGAAAAAGG - Intergenic
1079440799 11:20513053-20513075 TTGTGGTTTTGTTTTGAAATAGG + Intergenic
1080013423 11:27480654-27480676 TTTTGGTGATGTTTTGAAAAAGG - Intergenic
1080558223 11:33436977-33436999 TTGTGTTTGTGAAAGGAAAAAGG + Intergenic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1084995246 11:72970799-72970821 TTGGGGTTAGGTATACAAAATGG + Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1088080523 11:105906492-105906514 TTAAGGTGATATATGGAAAATGG + Intronic
1088100265 11:106146733-106146755 TTGGGGCTATGTATGGAAGGAGG - Intergenic
1090451786 11:126812666-126812688 GTGTGGTGCTGTATGGACAAAGG - Intronic
1091632738 12:2174136-2174158 GTGTGGCTTTGCATGGAAAAGGG + Intronic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1092704783 12:11270381-11270403 TAGGGGTTATGAATGCAAAATGG + Intergenic
1093206456 12:16257159-16257181 TTGTGGTTATGTTTTTCAAATGG + Intronic
1093385231 12:18544987-18545009 TTGTGGTTATGTATGGAAAATGG - Intronic
1094026604 12:25966132-25966154 TGGTGGTTAAGAATGTAAAATGG - Intronic
1094708526 12:32938193-32938215 TTTTGGTTATTTATGCCAAATGG + Intergenic
1095332570 12:40985909-40985931 CTGTGTTTCTGTATGGATAATGG + Intronic
1096974150 12:55689023-55689045 TTGAGGTCAAGTAAGGAAAATGG - Intronic
1097550922 12:61067688-61067710 TTGAGGTAATAGATGGAAAATGG - Intergenic
1097694211 12:62761361-62761383 ATGGGATTATGTATGAAAAAAGG + Intronic
1098083396 12:66813898-66813920 TTCTGGTTGTTTATGGAAAATGG + Intergenic
1098212236 12:68178971-68178993 TTGTGATTATGATTTGAAAAAGG + Intergenic
1098301494 12:69058805-69058827 TTGTCCTTATGTGTGGAGAAAGG + Intergenic
1099281640 12:80656182-80656204 ATGTGGTTATGTTTAGAAATGGG - Intronic
1099518233 12:83625492-83625514 TAGTTGTTACCTATGGAAAATGG + Intergenic
1101014852 12:100489730-100489752 TTGTATTTAGGTAAGGAAAATGG + Intronic
1102052517 12:109873135-109873157 TTTTGGTTTTGTATAGAACAGGG - Intronic
1102371415 12:112384949-112384971 TTGTTATTAGGTTTGGAAAAGGG - Intergenic
1106491899 13:30233460-30233482 TGATGGTCAGGTATGGAAAAAGG + Intronic
1107194613 13:37634639-37634661 TTCTGGTAAAGTATGTAAAATGG + Intergenic
1107264399 13:38535629-38535651 TAGAGGTGATGTATGGAAACAGG + Intergenic
1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG + Intergenic
1107914065 13:45131424-45131446 TTGTTGTTAAGTATGAAAGATGG + Intronic
1108121263 13:47189805-47189827 GTGTGATTTTGTATGGCAAAAGG + Intergenic
1108870709 13:54981653-54981675 TTGTGTTTATGTATGAAAAATGG + Intergenic
1110279400 13:73675350-73675372 TTGTGGTTAGTTGTGGAAATTGG - Intergenic
1112723267 13:102271638-102271660 TTATAGTTTTGTAGGGAAAATGG - Intronic
1112944168 13:104905662-104905684 TTATGAGTATGTATAGAAAAGGG - Intergenic
1113653538 13:112054651-112054673 TTTTCCTTTTGTATGGAAAATGG - Intergenic
1116644718 14:47511990-47512012 TTGTGCTTAGGTATGCAAAATGG - Intronic
1117077482 14:52118833-52118855 TTGGTTTAATGTATGGAAAATGG + Intergenic
1117697586 14:58381620-58381642 TAGTGGTTTTCTCTGGAAAAAGG + Intergenic
1118114392 14:62758787-62758809 TTGTAGGTTAGTATGGAAAAAGG + Intronic
1118639815 14:67781917-67781939 AAGTGGTTATGTATGGCACAGGG - Intronic
1120396771 14:83977042-83977064 TTGTAGTTATCTTTGGAAACCGG + Intergenic
1124474984 15:30025558-30025580 TTGTGGGTAGGTAGGGGAAAGGG - Intergenic
1124611305 15:31211122-31211144 TTGTGGTTATGTTTTTAAAAAGG + Intergenic
1125407410 15:39368075-39368097 TTGTGGGGAAGTATGCAAAAAGG - Intergenic
1126937580 15:53728425-53728447 TTGTGTTTTTGTCTGGAATACGG - Intronic
1127210662 15:56771403-56771425 TTGTGATTATTTATGGATATGGG - Intronic
1128668791 15:69558737-69558759 ATCTGGTTAAGTAAGGAAAATGG - Intergenic
1128727552 15:69999172-69999194 TTCTGGATATGGATGGAAAGTGG - Intergenic
1128728283 15:70003995-70004017 CTTTGGTTATGTATGCAGAAAGG - Intergenic
1131350949 15:91699171-91699193 TTGTCTTTAAGTATAGAAAAAGG + Intergenic
1133943550 16:10329900-10329922 GGGTGGTGATTTATGGAAAAAGG - Intronic
1133971534 16:10571642-10571664 TTCTGGATACGTATGGGAAACGG + Intronic
1134037237 16:11040300-11040322 TTGTGGGTAGGTATGGAAACAGG + Intronic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1135090060 16:19506821-19506843 TTGTGGCTATGTTTTTAAAAAGG + Intronic
1136100943 16:27995583-27995605 TTGTGGTTTTGCAGGGAAAGGGG - Intronic
1138924254 16:61571464-61571486 TTGTGGTTATATATACACAATGG - Intergenic
1139176033 16:64688772-64688794 TGGTGGTAGTGAATGGAAAAGGG + Intergenic
1140277558 16:73524213-73524235 ATGTGTTTATGTATAAAAAATGG - Intergenic
1140671246 16:77281240-77281262 TTATGATTAAGAATGGAAAATGG - Intronic
1141193565 16:81842624-81842646 TTGAGGTCATGTATGGGAATTGG + Intronic
1143059651 17:4189303-4189325 TGGTGGATATGTAGGAAAAAGGG - Intronic
1146236312 17:31167133-31167155 TTGTGGTTGTTTGTGAAAAATGG - Intronic
1146358597 17:32156047-32156069 ATGTAGTTATTTAAGGAAAAAGG + Intronic
1147190380 17:38734969-38734991 GTGTGTGTATGTGTGGAAAATGG - Exonic
1148292064 17:46461452-46461474 TTGTGGTTACCTATGGGGAAAGG + Intergenic
1149297300 17:55272536-55272558 ATGTGGTTGTGTGTGGGAAAAGG + Intronic
1150551099 17:66211035-66211057 TTGTGTTTATGAATTTAAAATGG + Intergenic
1151737443 17:75953044-75953066 CTGTGGCTATGAATGCAAAAGGG + Intronic
1154063245 18:11083286-11083308 TTGTGGTTCTTTATGAAAAGAGG + Intronic
1156134180 18:34016587-34016609 TTCTGATTATGTATGGGAGAGGG - Intronic
1156359821 18:36375068-36375090 CTTTGGTTATGTATAGAAAATGG + Intronic
1156506000 18:37593675-37593697 TACTGTTTGTGTATGGAAAAAGG + Intergenic
1157243192 18:46030274-46030296 GTGTGATAATATATGGAAAATGG + Intronic
1157571039 18:48712458-48712480 GTGTGGTCATTTATGCAAAAGGG + Intronic
1158610131 18:58932190-58932212 TTGTGCTTCTGTATCGAAAGTGG + Intronic
1159237462 18:65695427-65695449 TTGTGCTGATGAATGGATAAAGG - Intergenic
1160290098 18:77584539-77584561 ATGAGGTTATGAATGGAACAAGG + Intergenic
1161488494 19:4548631-4548653 TTGGGGTTATGTTTCAAAAAAGG - Intronic
1166443773 19:42840222-42840244 TTTTCCATATGTATGGAAAAAGG + Intronic
1167279319 19:48557573-48557595 ATGTGGTCTTGTATGTAAAAAGG + Intronic
1168464773 19:56593686-56593708 TTGTGGTTTACTATAGAAAAGGG + Intergenic
1168566617 19:57430005-57430027 TTGTGGTTTATTGTGGAAAAAGG + Intronic
925285644 2:2714026-2714048 TTGTGTTTATTTCTGGAAACTGG - Intergenic
925932553 2:8721038-8721060 TTGTCGTTATGAAAGGGAAAAGG + Intergenic
927393335 2:22621314-22621336 TTGTGCTTATGGATGGAGAGAGG + Intergenic
927681606 2:25143279-25143301 TAGTGGTTATCTCTGGAAATGGG + Intronic
929378419 2:41319207-41319229 TTGTGGTTGTGGATGGAAAGAGG - Intergenic
929400625 2:41577179-41577201 TATTGTGTATGTATGGAAAAAGG + Intergenic
929436116 2:41929643-41929665 TTAGGGTTGTGTATGGAAGAGGG + Intergenic
929541136 2:42823182-42823204 TTGGGCTTCTGTATGGAGAAAGG - Intergenic
932325016 2:70853386-70853408 TTGTTGTTATGTACTGTAAACGG - Intergenic
933650750 2:84848074-84848096 TTGTGACTATGTTTGGAAACAGG - Intronic
934333939 2:92105083-92105105 TTGTGGTTTTCCGTGGAAAAGGG + Intergenic
935581558 2:104760134-104760156 TTATGGTTAGGTAGGGACAAGGG + Intergenic
939385054 2:141485491-141485513 TTGTTGTTCTTTCTGGAAAATGG + Intronic
940286179 2:152035017-152035039 TTGTGATTAGGTCTGGAAATGGG - Intronic
940391968 2:153142697-153142719 GTGGTGTTATGTATGGAAATGGG + Intergenic
940393823 2:153164238-153164260 TAGTGGTTATCTCTGGAAAAGGG - Intergenic
940794741 2:158065083-158065105 ATGTGTTTATGCATTGAAAATGG - Intronic
941293381 2:163704014-163704036 TTGCTGTTTTGTTTGGAAAAGGG + Intronic
942166871 2:173249925-173249947 TTTGAGTTATGTATGAAAAAGGG - Intronic
942212662 2:173687277-173687299 TTCTGGGTATGTCTGGTAAATGG - Intergenic
943145696 2:184042387-184042409 TTGTAGTTATGTCTTGTAAATGG + Intergenic
943498701 2:188658556-188658578 TTGTCTTTATGCTTGGAAAATGG + Intergenic
943744418 2:191446591-191446613 TAGTGGTTATTTATGGGGAAGGG + Intergenic
943872847 2:193024081-193024103 ATGTGAGTATGTGTGGAAAAGGG - Intergenic
944203878 2:197136746-197136768 TGGTGGTTATGTCAGGCAAATGG - Intronic
944296622 2:198070969-198070991 TAGTGGTTATCTCTAGAAAAAGG - Intronic
945502433 2:210592670-210592692 TTTTGATTAAGTATGGAAAATGG - Intronic
945905186 2:215585124-215585146 TTGTGATTATGTTTTGAAAAAGG + Intergenic
946472651 2:219976834-219976856 TTGTGGTTATGTCAGAAAAAAGG + Intergenic
947770187 2:232664468-232664490 TTGTGGTTGTTTATAGAAACAGG + Intronic
1169306369 20:4494335-4494357 TTTTGGTTTTGTATATAAAAAGG + Intergenic
1170346244 20:15389962-15389984 TTGAGGTTCTGTGTGGGAAATGG + Intronic
1172839703 20:37894993-37895015 TGGTGGCTTGGTATGGAAAAAGG + Intergenic
1172985565 20:38985588-38985610 TTGTGTTTTTGTATGAAAATGGG + Intronic
1173592528 20:44236087-44236109 ATGTGGTTATATATGAAAATAGG - Intergenic
1173916506 20:46712052-46712074 TGGTGGTTATTTCTGTAAAATGG + Intronic
1174504080 20:51005367-51005389 CTCTGGCTATGTGTGGAAAATGG - Intronic
1177354906 21:19995901-19995923 CTGGGGCTATGTTTGGAAAATGG - Intergenic
1179475854 21:41643435-41643457 CTGTGGTTAGGAATGTAAAATGG + Intergenic
1179480763 21:41676852-41676874 CTGTGGTTAGGAATGTAAAATGG - Intergenic
1179661406 21:42878204-42878226 TTTAGGTTCAGTATGGAAAATGG - Intronic
1181681134 22:24496507-24496529 TTGTGATTTTATTTGGAAAAAGG - Intronic
1183506277 22:38210744-38210766 TTGTGGATATCTAGGGAACAAGG + Intronic
1183738776 22:39658635-39658657 TTTTGGTTATGAATGTAAACAGG - Intronic
1202716481 2_KI270715v1_random:9658-9680 TTGTGGTTTTCCGTGGAAAAGGG + Intergenic
1202728469 2_KI270716v1_random:33397-33419 TTGTGGTTTTCCGTGGAAAAGGG + Intergenic
949585986 3:5437736-5437758 TTGTGTGTCTGTATGAAAAAGGG + Intergenic
949931554 3:9082609-9082631 TTGAGTTTCTGTATCGAAAATGG + Intronic
950510674 3:13424394-13424416 TTGTGGTTATGTCTATAAAAGGG - Intergenic
950919820 3:16683131-16683153 ATGTGGTTATGTATGTAAACAGG - Intergenic
951752545 3:26053703-26053725 TTTTGGTGATGAAGGGAAAAAGG + Intergenic
953184348 3:40624462-40624484 TGGTGAATATGTATAGAAAAGGG + Intergenic
953668709 3:44944865-44944887 TTGTTTTTATATATGTAAAATGG - Intronic
954939126 3:54355050-54355072 ATGTGTTTGTGTATGAAAAATGG + Intronic
954982261 3:54756968-54756990 TTGTTTTAATGTATGTAAAATGG - Intronic
957740355 3:84259286-84259308 TTTTGGATCTGTTTGGAAAACGG + Intergenic
958273379 3:91538821-91538843 TTGTGGTTTTCTTTGGAAATGGG - Intergenic
958403307 3:93717557-93717579 TTGAGGTTTTCTTTGGAAAAGGG - Intergenic
958403388 3:93719254-93719276 TTGAGGTTTTCTTTGGAAAAAGG - Intergenic
959508603 3:107183138-107183160 TTGTCATTATGTAAGGAAAATGG - Intergenic
959647312 3:108717825-108717847 TTGTGGATGTGTAAGGAAATGGG - Intergenic
962985926 3:140535878-140535900 ATGTAATTATGTCTGGAAAAAGG + Intronic
963507458 3:146205166-146205188 TTGTTGTTGTTTATAGAAAAAGG - Intronic
963916670 3:150865072-150865094 GTGTGGTGCTGTGTGGAAAAGGG + Intergenic
967454414 3:189666847-189666869 TTGTGTGTATGTATGTAAATGGG + Intronic
970445167 4:16117300-16117322 TTGTGGATATTTGTGGAAAGAGG + Intergenic
972303614 4:37810394-37810416 GTGTGGTTATGTATGAGAATAGG + Intergenic
972354529 4:38268007-38268029 TTGTGGTTCTTTAATGAAAATGG + Intergenic
976143076 4:82013306-82013328 TTGTGGTAATGTTAGGAAATGGG + Intronic
977613967 4:99066584-99066606 TTCTGGTTATTTTTGAAAAAAGG + Intergenic
977972798 4:103230728-103230750 CTGGGGCTATGTTTGGAAAATGG + Intergenic
979509618 4:121537523-121537545 ATGTGGTTGTGTTTGGAATAAGG + Intergenic
979534462 4:121803899-121803921 TTATGCTTAGGTATGGAATATGG - Intronic
980252743 4:130338611-130338633 TTGTGGTGATAAATGGAATATGG - Intergenic
981421483 4:144555450-144555472 TTTTGGGAATGTATGGAGAAGGG - Intergenic
981432146 4:144673416-144673438 TTGTGGTAATGTAATGAAGAGGG + Intronic
981445722 4:144836199-144836221 TTGTGGTAATGTAGAGAAAAGGG - Intergenic
982685475 4:158483635-158483657 TTGTTGTTATGTTTGGGAAGTGG - Intronic
982915764 4:161206864-161206886 TTTTGGTTATGTGTGGAGGATGG + Intergenic
982942637 4:161577369-161577391 TTCTGTTTATTTATGGCAAATGG - Intronic
983677311 4:170310767-170310789 TTGTCGTTTTGTTTGGAATATGG + Intergenic
985726584 5:1519436-1519458 TTGTGGTTAACTTTGCAAAATGG - Intronic
986590677 5:9366244-9366266 TTGTGGAAATGTATGCAAATTGG + Intronic
988351063 5:30107609-30107631 TTGTAGTTATCCAAGGAAAAAGG + Intergenic
989033673 5:37146574-37146596 TTGTGCTTATGTTTTAAAAATGG + Intronic
989291697 5:39774673-39774695 TTGTGTTTAGGAATGTAAAATGG + Intergenic
990790932 5:59478476-59478498 TTCTGTTTATGTTTGAAAAATGG + Intronic
992521594 5:77557053-77557075 TTTTGTTTATGTGTGTAAAAGGG - Intronic
993610780 5:90051783-90051805 TTATGGTTATATCTGGGAAATGG + Intergenic
995080156 5:108041717-108041739 TTGGGGTTATTTAAAGAAAAGGG - Intronic
996712218 5:126554524-126554546 ATCTGGTTCTTTATGGAAAAAGG - Intronic
997782270 5:136671877-136671899 TTGAGGTTAAGTGTGTAAAAGGG - Intergenic
999134633 5:149310270-149310292 TAGGGCTTATGTATGGAAATGGG + Intronic
1000027404 5:157371338-157371360 TTATGTTTTTGTATGGAGAAAGG - Intronic
1000832168 5:166116428-166116450 TTGTGGGTGGGAATGGAAAATGG - Intergenic
1001467995 5:171986063-171986085 TTGTGGTTTTGTTTGAAAATTGG - Intronic
1001658529 5:173373062-173373084 TTGTGGATATGTATGTTACATGG + Intergenic
1001896649 5:175388320-175388342 TTTTATTTATGTATGTAAAAAGG + Intergenic
1004125747 6:12871469-12871491 ATGTGGTTTGTTATGGAAAATGG + Intronic
1004311299 6:14547739-14547761 ATGGGGGTATGTCTGGAAAATGG + Intergenic
1004521604 6:16366134-16366156 CTTTGGTGATATATGGAAAAGGG + Intronic
1005209231 6:23441474-23441496 TTTTGGTTATGTACAGCAAAGGG - Intergenic
1008849029 6:56001837-56001859 TTGGGGTTAGGTGAGGAAAATGG + Intergenic
1009200477 6:60738548-60738570 CTGTGGTTATCTATGGTAATTGG - Intergenic
1009391435 6:63148475-63148497 TTGTGGTTATGTTTGGATACAGG - Intergenic
1010624749 6:78123807-78123829 TTGTGTATATGAATGGAAGAAGG - Intergenic
1010634817 6:78245176-78245198 TTGTGGTGGTATTTGGAAAATGG - Intergenic
1011494303 6:87923473-87923495 TTGTATTTATTTATTGAAAATGG + Intergenic
1011710602 6:90048975-90048997 TTGTGTTAATGTAAGCAAAATGG + Intronic
1011877639 6:91980806-91980828 TTGTGTGTCTGTATGGGAAAGGG - Intergenic
1011933454 6:92742543-92742565 TTCTGGTCATATATAGAAAATGG - Intergenic
1013193577 6:107825548-107825570 TTGTTGTTTTGTATGGGAAAAGG + Intergenic
1015529303 6:134205142-134205164 TTGATGTTATGTAAAGAAAATGG - Intronic
1017294874 6:152781646-152781668 TTCTGGTTATGTATAGATCATGG + Intergenic
1017749515 6:157478401-157478423 TTGTGGTTAACTTTGGGAAAAGG - Intronic
1018657456 6:166052164-166052186 TTGTGGTTTTATATCTAAAATGG + Intergenic
1020462128 7:8437661-8437683 TTGTTGTAATGAGTGGAAAACGG - Intronic
1021010735 7:15461852-15461874 TTGTGGTTATATTTGGCAAAAGG + Intronic
1022561023 7:31349649-31349671 TAGTGGTTAAGGATGGCAAATGG + Intergenic
1023165817 7:37342848-37342870 TGGTGGTTTGGTATGAAAAACGG + Intronic
1023261872 7:38366898-38366920 TTGTGATTATGTACACAAAAAGG + Intergenic
1024193936 7:47040347-47040369 TAGTGGTTGTGTTTAGAAAAAGG - Intergenic
1024759933 7:52583331-52583353 TAGTGGTAAGGTATGGGAAAAGG - Intergenic
1024878784 7:54060435-54060457 ATGTGTGTATGTATGGAAAGGGG - Intergenic
1026112373 7:67468846-67468868 TTGTCGTTATTTAAGGAAAGTGG + Intergenic
1027330132 7:77083828-77083850 TTCTACTTATGTATGGAGAATGG + Intergenic
1028635915 7:92989369-92989391 TTGTGGTTATTTCTGGGAAGAGG + Intergenic
1029785632 7:102787506-102787528 TTCTACTTATGTATGGAGAATGG - Intronic
1030622241 7:111802460-111802482 TTTTGGGTATGTGTGAAAAAAGG + Intronic
1030625368 7:111840251-111840273 TTGTGGTGGGGTATGGAAATGGG - Intronic
1031467617 7:122133002-122133024 TTGTGGTTATGTAGAAAACATGG + Intronic
1033130176 7:138739324-138739346 TTGGGGGACTGTATGGAAAATGG + Intronic
1034735148 7:153422063-153422085 TTCTGATTATGAAGGGAAAAGGG + Intergenic
1038454470 8:27663663-27663685 GAGTGGTTATCTATGGAGAATGG + Intronic
1039782867 8:40804412-40804434 TTGTGGTTCTGTTTTCAAAATGG - Intronic
1042912349 8:73840469-73840491 TTGTGGTTATGAATCAAAACTGG + Intronic
1043131365 8:76466323-76466345 TCCAGGTTAAGTATGGAAAAAGG + Intergenic
1043190865 8:77221348-77221370 TGGTGGTGATGTTTGAAAAATGG - Intergenic
1044173842 8:89091710-89091732 TTGTGGTTATGTTTTTAAAGGGG + Intergenic
1044345786 8:91102866-91102888 TTGTGGTTTGGTATTGAAGATGG + Intronic
1044732575 8:95241588-95241610 TTGGGGTTAAGAATGTAAAAGGG - Intergenic
1047017295 8:120736787-120736809 GTGTGGTTATGTAATCAAAACGG - Intronic
1048398872 8:134044248-134044270 TTGTGGTTAAGAATAGAAAAGGG + Intergenic
1049024983 8:139982214-139982236 TTCCGGTTGTGCATGGAAAATGG + Intronic
1051406206 9:16740297-16740319 TAGTGCTTAAGGATGGAAAATGG + Intronic
1051689130 9:19690710-19690732 TTGTGTTCATTTATGCAAAAAGG - Intronic
1052062636 9:23979573-23979595 TTTTGGGTATGTATGGAGAATGG + Intergenic
1052112413 9:24603241-24603263 ATGTGGTAATGTATGATAAAAGG + Intergenic
1052332410 9:27283177-27283199 TTCTGGATATGTATGGATATGGG - Intergenic
1052492256 9:29184755-29184777 TTCTGGTTTTGTCTGGAGAATGG + Intergenic
1052962032 9:34306922-34306944 TTGTGTTTTTGCAAGGAAAAGGG - Intronic
1055357066 9:75448550-75448572 TTGAGGTTATGAAGGGAGAAAGG + Intergenic
1057319153 9:93996321-93996343 TGGTGGTTATGAAGGGGAAATGG - Intergenic
1057931143 9:99194348-99194370 TTGTGGGTATTTTTTGAAAATGG + Intergenic
1059208974 9:112493492-112493514 GCTTGATTATGTATGGAAAATGG - Intronic
1060250750 9:121985083-121985105 TTGTGGCTATGATTGGAAAGGGG + Intronic
1062113410 9:134795144-134795166 TTGTGGGCATGTTTGGGAAACGG + Intronic
1185953125 X:4458349-4458371 TTGTTTTTATGTAAAGAAAATGG - Intergenic
1186950619 X:14620626-14620648 TTGTGATAAAGGATGGAAAATGG - Intronic
1187371201 X:18707846-18707868 CTGTGGTTATGAATGAAAAGGGG + Intronic
1187851497 X:23595670-23595692 TTGTACCTATGCATGGAAAAGGG - Intergenic
1188196558 X:27241472-27241494 TTTTGGGTATGTCTTGAAAATGG + Intergenic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1189138899 X:38580352-38580374 TTTTTGCTAAGTATGGAAAACGG - Intronic
1189722816 X:43937662-43937684 TTTTGGTTATTTATTCAAAAAGG + Intergenic
1190425420 X:50330702-50330724 TTGGGGCCATGTTTGGAAAATGG - Intronic
1191882490 X:65856856-65856878 TTGTCATTTTGTAGGGAAAAGGG - Intergenic
1191999674 X:67135700-67135722 TTGTGGTTGGGAATGTAAAATGG - Intergenic
1192025545 X:67446756-67446778 TTGTGGTTATTTATGGAGCAGGG - Intergenic
1192262550 X:69514711-69514733 CTGCTGTTATGTATGTAAAATGG - Intronic
1192412484 X:70946424-70946446 TTGTCTTTATGTGGGGAAAAAGG + Intergenic
1193027421 X:76859182-76859204 TTGTGGTTTTGTGTTGAATATGG - Intergenic
1193700216 X:84750992-84751014 GTTTAGTTATGTATAGAAAAAGG + Intergenic
1194180491 X:90705618-90705640 TTATGGTTATGAATTTAAAATGG + Intergenic
1194662368 X:96641124-96641146 TTGGGGTTATGAAGGGAAAGTGG - Intergenic
1194988277 X:100515467-100515489 TTGCTGGTATGTATGTAAAATGG - Intergenic
1195515854 X:105774943-105774965 TCGTGGTTATGTCTTGATAAAGG + Intergenic
1196321394 X:114344608-114344630 ATGATGTTATGCATGGAAAAAGG - Intergenic
1197563192 X:128049272-128049294 TTGTGGCTATGTTTGTACAATGG + Intergenic
1200527156 Y:4287778-4287800 TTATGGTTATGAATTTAAAATGG + Intergenic
1200947803 Y:8864007-8864029 AAGTGGCTATGTATGGAAACTGG - Intergenic
1202189966 Y:22231540-22231562 TTCTGGCTATGGTTGGAAAAGGG + Intergenic