ID: 1093385297

View in Genome Browser
Species Human (GRCh38)
Location 12:18546003-18546025
Sequence GGGTCCACAAATTCTCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093385297 Original CRISPR GGGTCCACAAATTCTCACAT GGG Intronic
903118657 1:21198792-21198814 GGGGCAAGAAACTCTCACATAGG + Intergenic
903807726 1:26017419-26017441 GTGTCCTCAAATTCACACAAAGG + Intergenic
905278145 1:36832499-36832521 GGGTCCACAAATTTGAACAGAGG + Intronic
906431882 1:45761769-45761791 GGGGCCTAAAATTCTCACAAGGG - Intergenic
916660110 1:166915726-166915748 TAGTCCACAAAATTTCACATAGG - Exonic
918839157 1:189512754-189512776 AGGTATACAAATTCTCTCATTGG + Intergenic
919887165 1:201943087-201943109 GAGACCACAAATTCTTATATTGG - Intronic
921211142 1:212899807-212899829 CAGTCCACAATTTCTCCCATGGG + Intergenic
1066025164 10:31349468-31349490 GGGTCCTCAAAAACTAACATTGG - Intronic
1067312421 10:45126625-45126647 GGGTCAACAGATCCTCCCATGGG + Intergenic
1068528523 10:58158655-58158677 GCCTCCAAATATTCTCACATGGG - Intergenic
1070086353 10:73240960-73240982 GGGTCTACAAAATCTCAAAGCGG + Exonic
1073138182 10:101230949-101230971 TGGGCCACAAATCCTCACTTTGG - Intergenic
1074408189 10:113199307-113199329 CAGTCCACAAGTTCTCCCATCGG + Intergenic
1074889025 10:117720016-117720038 GGGTGCACAAATTCTAAGGTAGG + Intergenic
1075161808 10:120030988-120031010 CTGTCCCCAAATTCACACATTGG + Intergenic
1076680620 10:132169542-132169564 GGATCCACAAACCCTCCCATAGG - Intronic
1088166177 11:106940298-106940320 AGATCCACAAATTTCCACATAGG + Intronic
1093065620 12:14655247-14655269 AGGTCAACAAATTCTCTCTTTGG + Intronic
1093385297 12:18546003-18546025 GGGTCCACAAATTCTCACATGGG + Intronic
1098321997 12:69255331-69255353 GGGTACACAAATATTCACAGGGG - Intronic
1099410401 12:82319288-82319310 GTCTCCATAAATTCTCAAATTGG + Intronic
1106416021 13:29546614-29546636 CAGTCCACCAATTCACACATAGG + Intronic
1110125612 13:71939396-71939418 GGGTACATAAATTATCACAGAGG + Intergenic
1110201413 13:72853945-72853967 GGGTCCCCAACTTCTCAGATGGG + Intronic
1129116360 15:73367575-73367597 GGGTCAACAAATTCTCCCTAAGG - Exonic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1141866060 16:86750755-86750777 GGGTCCACAAGATCACAGATGGG - Intergenic
1146747136 17:35341751-35341773 GAGACCACAAATTCTCAGAAGGG - Intergenic
1147683704 17:42274445-42274467 GATACCACAAATTGTCACATAGG + Intronic
1158078571 18:53561970-53561992 GGGTCCATTAAGACTCACATGGG - Intergenic
1158624879 18:59062492-59062514 GGTTGCACAAATTTGCACATGGG - Intergenic
1161477115 19:4492439-4492461 GGCACCACATATACTCACATAGG - Intronic
926383807 2:12316575-12316597 GTGTCCACAACACCTCACATTGG - Intergenic
926746790 2:16165477-16165499 GGGTCCACACTTTGTCACAGTGG - Intergenic
926807156 2:16721678-16721700 GGGTATAAAAATTCTCACAGAGG - Intergenic
931973227 2:67613552-67613574 TGGTCTACAAATTGTCACCTTGG + Intergenic
933632232 2:84671597-84671619 GGGGCCCCAAATTCTTACAAAGG + Intronic
938935216 2:136121637-136121659 GGGTCCCCAACTTCTCAGGTTGG + Intergenic
942127413 2:172841099-172841121 GGCTCCACAAAGTCTCATGTTGG + Intronic
947637649 2:231688267-231688289 GGGTCCACACATTGTCCCAAAGG - Intergenic
1172934182 20:38607840-38607862 GGCTCCACATCTTTTCACATAGG + Intronic
1175225757 20:57442909-57442931 GGGGCCGCACATTCTGACATAGG - Intergenic
1177206637 21:18017847-18017869 GGCTCCACAGCTTCTCCCATAGG - Intronic
1177828691 21:26112416-26112438 GGTACCACAAAATCTCATATGGG - Intronic
1178467077 21:32858694-32858716 GGCACCACAAATTCCCACTTTGG + Intergenic
1178495470 21:33082168-33082190 TGATTAACAAATTCTCACATGGG - Intergenic
951749181 3:26014750-26014772 GGGTCCATAAATTGTTTCATTGG - Intergenic
952657732 3:35806864-35806886 GGGTCCTCCAATTTTCACACAGG - Intergenic
961123127 3:124391023-124391045 GGTTCTAGAAATTCTCAAATTGG + Intronic
961438983 3:126940012-126940034 GTGTCCACACATTCTCTGATAGG + Intronic
967399777 3:189048423-189048445 GGGTCCCAAAATTCTCAGAAAGG + Intronic
983962294 4:173769470-173769492 GTGTCCACAAATTCTCCAACTGG - Intergenic
984048346 4:174831280-174831302 GGGTGCATTAATTATCACATTGG + Intronic
986110124 5:4707664-4707686 GTGACCACCAACTCTCACATTGG + Intergenic
990923947 5:60997431-60997453 GGGTGACTAAATTCTCACATTGG - Intronic
996845504 5:127894787-127894809 GAGGCCACAAATTCGCCCATAGG + Intergenic
1000533771 5:162456029-162456051 GGGTCCTCAAATGCTCACATAGG - Intergenic
1000644743 5:163747656-163747678 GGGAACACAAATGCTCACATTGG - Intergenic
1003422355 6:5969702-5969724 GGGTCCAGGAATTTTCATATGGG + Intergenic
1006831676 6:36971830-36971852 GTGTCCAGACATTCTCACAGTGG - Intronic
1011481008 6:87793686-87793708 GGAAACACAAATTCTAACATTGG - Intergenic
1011746840 6:90414593-90414615 GGGTCCACAAAATCGCCCAGTGG - Intergenic
1011976506 6:93307212-93307234 GGTACCACATATTGTCACATTGG - Intronic
1012151083 6:95754484-95754506 GGGTCCTCAAATATTCAAATTGG + Intergenic
1016662546 6:146598532-146598554 GGGTCCAGAAATTAACACAGTGG - Intergenic
1023077531 7:36498912-36498934 GGTTCCACATATTGTCAAATTGG + Intergenic
1032473502 7:132195675-132195697 GGTTTCATAAATTTTCACATGGG + Intronic
1032537012 7:132672661-132672683 GGGTCCATACATCCTCACATTGG - Intronic
1038463324 8:27735489-27735511 GGGCCCAGAAGTTGTCACATAGG + Exonic
1047661879 8:127046320-127046342 GGGTCCGTAAATTCCCACAGTGG - Intergenic
1055794403 9:79959459-79959481 AGGGCCACAAGGTCTCACATGGG - Intergenic
1056304969 9:85281427-85281449 GGTGCCACAAACTCTGACATGGG - Intergenic
1188787020 X:34359512-34359534 GGCTCATCAAATTTTCACATAGG - Intergenic
1196999313 X:121421181-121421203 AGTTCCCCAAATTCTCACAATGG + Intergenic
1197248358 X:124189548-124189570 GGTTCCAGAAGGTCTCACATTGG - Intronic