ID: 1093390569

View in Genome Browser
Species Human (GRCh38)
Location 12:18614618-18614640
Sequence ATCTTCACATTTAAGAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093390569_1093390571 -7 Left 1093390569 12:18614618-18614640 CCTTAGCTCTTAAATGTGAAGAT 0: 1
1: 0
2: 0
3: 10
4: 205
Right 1093390571 12:18614634-18614656 TGAAGATTTTCCAGTATTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 1045
1093390569_1093390570 -8 Left 1093390569 12:18614618-18614640 CCTTAGCTCTTAAATGTGAAGAT 0: 1
1: 0
2: 0
3: 10
4: 205
Right 1093390570 12:18614633-18614655 GTGAAGATTTTCCAGTATTCAGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093390569 Original CRISPR ATCTTCACATTTAAGAGCTA AGG (reversed) Intronic
904557948 1:31377521-31377543 ATGTTTACAGTTAAGAGTTAAGG - Intergenic
905005795 1:34709364-34709386 ATCTTCCAATTCAAGAGATAAGG + Intergenic
908342979 1:63201473-63201495 ATCATCACAGTGAAAAGCTAAGG + Intergenic
909039601 1:70633073-70633095 ATTCTCACATTTAGCAGCTAGGG + Intergenic
909141913 1:71877809-71877831 ATGTTCACATTTTTGAGATATGG - Intronic
909965075 1:81899474-81899496 ATCTTGACATTTTATAGCTTGGG + Intronic
910493160 1:87795331-87795353 ATCTCCCCATTTAAAAGCGATGG - Intergenic
910730064 1:90385410-90385432 ACTTTTACATTTAAGATCTATGG - Intergenic
911544278 1:99197845-99197867 ATCTTCACAGCTCAGAGTTATGG - Intergenic
911588016 1:99713562-99713584 AATTTCACATTTCAGAGCTTGGG - Intronic
913247889 1:116886363-116886385 ATTTTCAGATTTAACTGCTAAGG + Intergenic
914247184 1:145895100-145895122 ATCTTCCCATTTTAGAGATTAGG + Intronic
915188822 1:154130964-154130986 TTCATAACATATAAGAGCTAGGG + Intronic
919176207 1:194021730-194021752 ATCTAAACATAGAAGAGCTATGG - Intergenic
922207710 1:223462804-223462826 TTCCTCACACTTAAGAGCTCCGG + Intergenic
922976650 1:229790196-229790218 GTGTTCAAATTTAAGTGCTACGG - Intergenic
1063585525 10:7349159-7349181 ATTTTCACATTTATGATCTCTGG - Intronic
1063615331 10:7595210-7595232 TTATTTACATTTTAGAGCTAGGG - Intronic
1065049459 10:21776747-21776769 ATCTTAACTTTTAAAAGCGAAGG + Intronic
1065419716 10:25529672-25529694 ATCTTCACATCTAAGTGATTTGG - Intronic
1065529832 10:26657794-26657816 ATATACACAATTAAGAGATACGG - Intergenic
1065557115 10:26927330-26927352 ATATACACAATTAAGAGATAGGG + Intergenic
1065872793 10:29970329-29970351 ATGCTCAAATTTAAGAGCCATGG + Intergenic
1066211147 10:33239798-33239820 ACCTTCTTATTTTAGAGCTAAGG + Intronic
1066211544 10:33244311-33244333 ATGTTCACATTTAGGAGCAATGG - Intronic
1067927409 10:50524089-50524111 ATGCTCACTTTTAAGATCTAGGG - Intronic
1069765998 10:70860686-70860708 ATCTTCAAATTTACCAGATAAGG - Intronic
1071713887 10:88075932-88075954 TTCCTGACATTTAGGAGCTAGGG + Intergenic
1075833311 10:125429597-125429619 ATATTCCCAATAAAGAGCTATGG + Intergenic
1076012324 10:126999967-126999989 AGATACACATTTAAGGGCTAGGG - Intronic
1078629087 11:12985390-12985412 ATTTGCACATTCAAGAGCTGAGG + Intergenic
1079088554 11:17464625-17464647 ATCTCCAGATTTAAGACCTGGGG + Intronic
1080360541 11:31508353-31508375 ATCTTGTCATTTTAGACCTATGG - Intronic
1081084956 11:38787799-38787821 ACCTGCACTTTTAAGACCTAAGG - Intergenic
1084120869 11:67068271-67068293 AGCTGCACATTTAGAAGCTACGG + Intronic
1086186525 11:84023825-84023847 ATCTTCACATTGAGTAGGTAAGG - Intronic
1087506277 11:99026778-99026800 ATCTTCAAATTTAAGAGATGTGG - Intronic
1089822778 11:121243649-121243671 AACTTCACAATTAAGAGCACAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091834270 12:3574367-3574389 ATCTCCAGATTTGAGAGCCAGGG - Intronic
1091975176 12:4818731-4818753 ATAAACACATTTAGGAGCTATGG - Intronic
1093390569 12:18614618-18614640 ATCTTCACATTTAAGAGCTAAGG - Intronic
1094220184 12:27984611-27984633 ATCTCCCCAGTTAAGAGCTTTGG - Intergenic
1094299047 12:28940353-28940375 ATCTTCACATTTTAGTTCAAAGG + Intergenic
1095367601 12:41426608-41426630 ATTTTCACATTTAAAAACTCAGG - Intronic
1096328294 12:50685882-50685904 AACTTCACTGGTAAGAGCTAAGG - Exonic
1097768612 12:63553765-63553787 ATGTTCTCATTTAACAGGTAAGG + Intergenic
1097832218 12:64237251-64237273 ATGTACACATTGCAGAGCTAGGG - Intergenic
1100105562 12:91167700-91167722 ATCTTCTCATTTCATAGGTAAGG + Intronic
1100754066 12:97730898-97730920 ATGTTCAAATTCAACAGCTAAGG - Intergenic
1102417107 12:112773392-112773414 AACTTCACATTTCAAAGCTGGGG - Intronic
1103060800 12:117856897-117856919 ATCTTCAAAAATATGAGCTATGG + Intronic
1105748227 13:23397648-23397670 CCTCTCACATTTAAGAGCTAAGG + Intronic
1108061053 13:46533936-46533958 ATCTTCACAACGAAGAGATATGG - Intergenic
1108981963 13:56525120-56525142 ATTTTCACATTTAAGCACCATGG - Intergenic
1109447515 13:62462016-62462038 ATCTTCACATTTCACAGATGGGG + Intergenic
1111659962 13:91196759-91196781 TTCTTCACATTGAAGACCAAAGG - Intergenic
1112338077 13:98530896-98530918 ATATTCTCAGTTAAGAGTTATGG - Intronic
1113974944 13:114220518-114220540 ATCTTCTCATTTTGGAGTTAGGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118901605 14:69990943-69990965 AGCTTAAGATTCAAGAGCTATGG - Intronic
1120320250 14:82950480-82950502 CTCTTCAGATTTATGAGGTAAGG - Intergenic
1120901328 14:89578330-89578352 ATCTTGACATTTTAGTGCTCAGG + Intronic
1121012885 14:90532487-90532509 TTCTTCACCTTTAAGAGGGATGG - Exonic
1123687824 15:22812001-22812023 ATCTGCACATTTAAGGGGTCAGG - Intronic
1125475579 15:40046029-40046051 ATCTTCCCATTTTACAGCTGAGG - Intergenic
1125562412 15:40645886-40645908 AACTTAACAATTAAGAGGTAAGG + Intronic
1129507026 15:76089923-76089945 ATCTTCCCAGTTAAGAGCCATGG - Intronic
1130701583 15:86188324-86188346 TTTTTCACATCTAAGAGCTGGGG - Intronic
1131025603 15:89138901-89138923 ATCTTCACAATTCTGAGCAATGG - Intronic
1131840185 15:96428839-96428861 ATCTTCACAGTGTACAGCTATGG - Intergenic
1135047136 16:19165267-19165289 GTATTCACAGTTCAGAGCTAAGG + Intronic
1135911501 16:26565665-26565687 ATCTTCTTATTTTAGAGGTAGGG - Intergenic
1137341505 16:47611356-47611378 ATTTTTACATTTAGTAGCTATGG + Intronic
1138500301 16:57437880-57437902 ATTATAACATTTAAGAGCTTAGG - Intronic
1139409008 16:66743796-66743818 ATCTTCACATTTAAATACAAAGG - Intronic
1140425734 16:74859765-74859787 ATCTTTATCTTTAAGAACTAAGG + Intergenic
1142674947 17:1507923-1507945 ATCTTCACATGGAAAAGCCAGGG - Intronic
1146383125 17:32346167-32346189 ATCTTAACACTTAGAAGCTAAGG + Intronic
1148065814 17:44868949-44868971 GTCTTGACTTTTAAAAGCTATGG - Intronic
1148377396 17:47160533-47160555 ATCCTCCTATTTAAAAGCTAAGG - Intronic
1149775018 17:59350409-59350431 TTATTCATATTTAAGAGCAATGG + Intronic
1153381219 18:4441620-4441642 ATCTCCACATGTAAGACGTATGG + Intronic
1153794085 18:8607056-8607078 ATCTTCACATTGAGTAGCTGAGG + Intergenic
1159067071 18:63581927-63581949 ATCTTCACATTGAGTAGCTGAGG - Intergenic
1159108832 18:64032727-64032749 CCCTTCACATTTAATTGCTAAGG - Intergenic
1159464518 18:68764083-68764105 ATCTTAACATTCAAAAGCCAAGG + Intronic
1160341434 18:78092548-78092570 ATCTACATATTTAAAAGTTACGG - Intergenic
1164136976 19:22425083-22425105 ATGGTCTCATTTAAGAGTTAGGG + Intronic
1164627950 19:29741828-29741850 ATCTTCACACTCTGGAGCTATGG - Intergenic
927060816 2:19417497-19417519 ATCTTCACCTGGGAGAGCTACGG + Intergenic
928448282 2:31352771-31352793 AACTTCACACTTCAGATCTAGGG - Intronic
928518754 2:32067458-32067480 TTCTTCAAATCTAAGAGCTCAGG - Intronic
929335449 2:40738549-40738571 ATCTTCACATTGAGTAGCTGAGG - Intergenic
931175958 2:59855648-59855670 ATTTTCTCATTTAAGAGTTTGGG - Intergenic
931594425 2:63926333-63926355 ATTTTCACATTTACTAGTTAGGG - Intronic
933475341 2:82782623-82782645 ATTTTCACATTTCAGTGCTGGGG - Intergenic
938961674 2:136349452-136349474 TTCTTAAAATTTAAGAGATATGG + Intergenic
939023988 2:136990101-136990123 ATTTTCTCATTTAAGAACTGAGG + Intronic
939413075 2:141856987-141857009 ATTTTCACATTTTAGAGTTGAGG - Intronic
939527186 2:143310910-143310932 ATCATCATATTTAAGAAGTATGG - Intronic
941161617 2:162042101-162042123 AAGATCACATTTAAGAGCAAAGG + Intronic
944341945 2:198611663-198611685 ATTTTCCCATTTTAGAGATAAGG - Intergenic
944502962 2:200380687-200380709 AATTTCACATTTAAAAGCTCTGG - Intronic
946954103 2:224909851-224909873 AATTTTACATTTAAGAGATAGGG + Intronic
947358078 2:229317820-229317842 AGCTTCACCTTTAAGATCAATGG - Intergenic
1170749555 20:19133436-19133458 ATCTGCACATTCAAGGTCTAGGG - Intergenic
1171396830 20:24839975-24839997 ATCTTCTCACTTAACAGCTCAGG - Intergenic
1172950640 20:38721440-38721462 ATTTTCACATTTTAGAGATGAGG + Intergenic
1173327902 20:42050358-42050380 ATTTTCAGATTTAAGAACTGAGG + Intergenic
1178094066 21:29195275-29195297 ATATTCACATTCAAGAGTTTGGG + Intronic
1178472614 21:32906917-32906939 ATAGTCACATTGAAGAGTTAGGG + Intergenic
1179296150 21:40064794-40064816 GTCTAGACATTAAAGAGCTAAGG + Intronic
1181044929 22:20209978-20210000 ATCTTCACATTCAAGACCCCAGG + Intergenic
1182606787 22:31511951-31511973 ATCTGCAAATTTAACACCTAAGG - Intronic
1184675745 22:46042089-46042111 ATGTTCACCTTTAAGAGACAGGG - Intergenic
1184753218 22:46500955-46500977 ATCTTAACATTTCAGATCTTTGG - Intronic
953553808 3:43926106-43926128 ATTGTCTCATTTCAGAGCTAGGG + Intergenic
954206543 3:49063396-49063418 ATGGTCAAATTTAAGAACTAGGG + Intronic
955040723 3:55315147-55315169 ATATTCACATTGAAGGGCAAAGG + Intergenic
956250110 3:67226762-67226784 ATCTTCCCAGTTAAGGTCTATGG + Intergenic
956316612 3:67944691-67944713 ATTTTTCCTTTTAAGAGCTAAGG + Intergenic
958510472 3:95040309-95040331 ATGTCTACTTTTAAGAGCTAGGG + Intergenic
958864395 3:99484284-99484306 AACTTCACATTTCTGAACTAGGG - Intergenic
959399811 3:105886207-105886229 TTCTTCATTTTTAATAGCTATGG + Intergenic
959774390 3:110139308-110139330 CTCTTCAAATTTAAGAGAAACGG - Intergenic
962019975 3:131489580-131489602 ATCTTTACATTGAGGTGCTATGG + Intronic
963881696 3:150535567-150535589 ATCTTCAAATGTATGAGGTATGG - Intergenic
964862994 3:161222076-161222098 ATTTTCACATTTAAGGGGGAAGG - Intronic
965820085 3:172676430-172676452 ATTTGCATATTAAAGAGCTAAGG + Intronic
966023373 3:175243812-175243834 ATCTTCCCATTTCAGACCTTGGG - Intronic
967614116 3:191544686-191544708 AATTACACATTTAACAGCTATGG - Intergenic
971797295 4:31244321-31244343 ATCTTCATATTTAACTTCTAGGG - Intergenic
972007802 4:34133206-34133228 ATCTTCACATTCAAGTTATATGG + Intergenic
973657428 4:53063530-53063552 ATCATCTCCTTTAAGAGATAAGG + Intronic
974362945 4:60906485-60906507 ATTTTCACATTTCAAAGCTACGG + Intergenic
974490893 4:62563290-62563312 ATCTCCACATTCAAGTCCTATGG + Intergenic
975108880 4:70601184-70601206 AGCTTCACCTTTACGAGCAATGG + Intronic
975675541 4:76824089-76824111 TTATTCACATTTCAGAGGTATGG + Intergenic
975768608 4:77696544-77696566 ATATGCACTTTTAAGAGGTAGGG - Intergenic
976300685 4:83513024-83513046 ATCTTAAAATTTAAGAGCCACGG + Intronic
976583870 4:86772600-86772622 ATTTTAACATTTAACAGATATGG + Intronic
977222292 4:94352117-94352139 ATCTTCACAATTCTGAGCCAGGG + Intergenic
978992101 4:115097084-115097106 AACTTCACATTTAGAAGGTAAGG - Intronic
979476732 4:121167363-121167385 ATTATCACCTTTAATAGCTATGG + Intronic
980718321 4:136657919-136657941 ATCTTCACATTTAAAGTGTAGGG - Intergenic
981854269 4:149268745-149268767 AGATTCACATTTAAGAACAAAGG - Intergenic
981963365 4:150569723-150569745 GTCTTCACATTTAATAGTGAGGG + Intronic
982275193 4:153630926-153630948 ATTTTCACATTTCAGAGCCCTGG + Intronic
982330837 4:154180410-154180432 ATCTTCTCATTGAAAAGCCAAGG + Intergenic
983509782 4:168595672-168595694 ATATTCACTTTGAAGAGCCAAGG - Intronic
984330657 4:178312038-178312060 ACATATACATTTAAGAGCTAAGG + Intergenic
984451062 4:179902753-179902775 AAATTCAAATATAAGAGCTATGG - Intergenic
985126999 4:186704378-186704400 ACCTACACATTTAAGAGATTGGG - Intronic
985850402 5:2384381-2384403 GTCTTCACACTTGAGAGCCAAGG - Intergenic
986055346 5:4130853-4130875 AACATCACATTGAAGAGCTGGGG + Intergenic
987598661 5:20036304-20036326 ATCCTCACAATCAATAGCTACGG - Intronic
988502053 5:31791737-31791759 TACTTCACATTGAACAGCTAGGG + Intronic
988782113 5:34531873-34531895 TTCTTCACATTTTAGAGATACGG + Intergenic
989166063 5:38434575-38434597 ATCCTTACATTTGAGAGCTCTGG - Intronic
990150027 5:52806944-52806966 ATTTTCAGATTTCAGTGCTAAGG + Intronic
990734447 5:58844689-58844711 ATTTTCTCATTTAGGAGCTTGGG + Intronic
994935847 5:106252818-106252840 GTCTTCACATTTCACAGATAAGG + Intergenic
995369756 5:111405905-111405927 ATCTTGACAGTAAAGATCTAAGG - Intronic
996303685 5:122021383-122021405 ATCTTCACATTTTAGAGTGAAGG + Intronic
998543983 5:143010355-143010377 TTATTCACATTTTAGAGATATGG - Intronic
999845389 5:155473957-155473979 AGCTTCACATTTATGAGCTTTGG - Intergenic
1000445353 5:161312329-161312351 ATCTTCAGATCTCAGAGCTAAGG - Intronic
1003075440 6:2980000-2980022 ATCATCAAATATGAGAGCTACGG + Intergenic
1003374896 6:5567614-5567636 ATCTTAACATGTAGGACCTAGGG - Intronic
1003773438 6:9333983-9334005 CCCATCACCTTTAAGAGCTAGGG + Intergenic
1003909332 6:10729055-10729077 ATCTACACATCTAAGAAATATGG - Intronic
1006531774 6:34661516-34661538 AACTACACATTTGAGAGCTCTGG + Intronic
1011270151 6:85570182-85570204 ATCTTCACTTTTAATCACTAGGG + Intronic
1011877580 6:91980193-91980215 TTCAACACAGTTAAGAGCTATGG + Intergenic
1014941028 6:127438885-127438907 ATCTTCAATATTAAGAGGTAGGG + Exonic
1015737658 6:136418114-136418136 GTATTCACATTTGAGAGCAATGG + Intronic
1017353027 6:153466848-153466870 ATCTTAAAATTTAAGATCAATGG - Intergenic
1020158192 7:5745085-5745107 ATCTCCACCTGTAAGATCTACGG + Intronic
1021439088 7:20657784-20657806 ATCTTCACATTTAAAAAATCAGG - Intronic
1023487341 7:40701123-40701145 GTCTTCACATTTAAAATCTCTGG - Intronic
1023508318 7:40923111-40923133 TTCTTCACATTTATAGGCTAAGG - Intergenic
1028890288 7:95979545-95979567 ATGTTCTCATTTCAAAGCTATGG - Intronic
1029701812 7:102252149-102252171 AGCTTCACATCAAAGATCTAAGG - Exonic
1033836866 7:145325062-145325084 ATCTTAATATTTCAGAGCTTAGG + Intergenic
1036004194 8:4643576-4643598 ATTTTTTTATTTAAGAGCTAAGG + Intronic
1036581118 8:10076840-10076862 ATCTCAACATTTAAGAGCAGAGG + Intronic
1039781136 8:40787044-40787066 ATCTTTACATTTTACAGTTAAGG - Intronic
1040047924 8:42981951-42981973 ATCTTTACATTTAAAAAGTAAGG + Intronic
1041184712 8:55286973-55286995 ATTTTCACATTTTACAGGTATGG - Intronic
1041387376 8:57318826-57318848 ATTTGCATATTAAAGAGCTAAGG - Intergenic
1041479497 8:58303021-58303043 AGCTTCATATTTCAGATCTATGG - Intergenic
1044208189 8:89517015-89517037 ATATTAACATTTAAGAAGTAGGG + Intergenic
1044215607 8:89606518-89606540 ATCTTCATCTATAATAGCTAAGG + Intergenic
1044339942 8:91035575-91035597 ACCTTCACATTTAATGACTAGGG - Intronic
1044742865 8:95345364-95345386 GACTTCACATTTCAGAGCAAAGG + Intergenic
1047397398 8:124514142-124514164 ATCTTCACACTTCAGAACTTTGG + Intronic
1047452261 8:124975362-124975384 ATCTTCACATTAAAGGTCTGAGG - Intronic
1048406577 8:134128599-134128621 ATCTGCACATTTACAAGCTCAGG - Intergenic
1048569918 8:135643633-135643655 ATCATCACATTTAATGACTACGG - Intronic
1055379310 9:75688901-75688923 GACTTGCCATTTAAGAGCTAGGG + Intergenic
1058234542 9:102473397-102473419 ATTTTGATTTTTAAGAGCTATGG + Intergenic
1058561576 9:106234487-106234509 CCCTTCACATGGAAGAGCTAAGG + Intergenic
1186859579 X:13658622-13658644 ATATTCACATTTCAGAGGGAAGG - Intronic
1187585270 X:20653873-20653895 ATCTTTATATTTACAAGCTAGGG + Intergenic
1187743529 X:22383391-22383413 AACTTAACATTTAAGAACTGGGG - Intergenic
1188634263 X:32408482-32408504 ATCCTCAGATATAAAAGCTATGG - Intronic
1189620426 X:42831252-42831274 TACTTCACATGTAAGAGCTCTGG - Intergenic
1190055142 X:47177037-47177059 ATATTCACATTTTAGAGATGGGG - Intronic
1191889566 X:65926333-65926355 ATTTGCATATTTAAAAGCTAGGG - Intergenic
1197523636 X:127532478-127532500 ATCTTCTGATTTAAGAGCATGGG - Intergenic
1198573843 X:137988206-137988228 ATCTTCATATTTTAGAGCTGGGG + Intergenic
1202169347 Y:22024755-22024777 ATCTTTACATTTAATACCTGTGG + Intergenic
1202222015 Y:22561610-22561632 ATCTTTACATTTAATACCTGTGG - Intergenic
1202321100 Y:23634057-23634079 ATCTTTACATTTAATACCTGTGG + Intergenic
1202549667 Y:26035999-26036021 ATCTTTACATTTAATACCTGTGG - Intergenic