ID: 1093391525 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:18629799-18629821 |
| Sequence | AAATATCTCGGGTTTATCCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 97 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 87} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1093391525_1093391530 | 12 | Left | 1093391525 | 12:18629799-18629821 | CCTAGGATAAACCCGAGATATTT | 0: 1 1: 0 2: 0 3: 9 4: 87 |
||
| Right | 1093391530 | 12:18629834-18629856 | ATGATAGACATTTTATTCCTTGG | 0: 1 1: 0 2: 0 3: 23 4: 288 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1093391525 | Original CRISPR | AAATATCTCGGGTTTATCCT AGG (reversed) | Intronic | ||