ID: 1093391530 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:18629834-18629856 |
Sequence | ATGATAGACATTTTATTCCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 312 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 23, 4: 288} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1093391526_1093391530 | 1 | Left | 1093391526 | 12:18629810-18629832 | CCCGAGATATTTTCACTTTACCC | 0: 1 1: 0 2: 0 3: 19 4: 205 |
||
Right | 1093391530 | 12:18629834-18629856 | ATGATAGACATTTTATTCCTTGG | 0: 1 1: 0 2: 0 3: 23 4: 288 |
||||
1093391525_1093391530 | 12 | Left | 1093391525 | 12:18629799-18629821 | CCTAGGATAAACCCGAGATATTT | 0: 1 1: 0 2: 0 3: 9 4: 87 |
||
Right | 1093391530 | 12:18629834-18629856 | ATGATAGACATTTTATTCCTTGG | 0: 1 1: 0 2: 0 3: 23 4: 288 |
||||
1093391527_1093391530 | 0 | Left | 1093391527 | 12:18629811-18629833 | CCGAGATATTTTCACTTTACCCT | 0: 1 1: 0 2: 0 3: 28 4: 385 |
||
Right | 1093391530 | 12:18629834-18629856 | ATGATAGACATTTTATTCCTTGG | 0: 1 1: 0 2: 0 3: 23 4: 288 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1093391530 | Original CRISPR | ATGATAGACATTTTATTCCT TGG | Intronic | ||