ID: 1093391530

View in Genome Browser
Species Human (GRCh38)
Location 12:18629834-18629856
Sequence ATGATAGACATTTTATTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093391526_1093391530 1 Left 1093391526 12:18629810-18629832 CCCGAGATATTTTCACTTTACCC 0: 1
1: 0
2: 0
3: 19
4: 205
Right 1093391530 12:18629834-18629856 ATGATAGACATTTTATTCCTTGG 0: 1
1: 0
2: 0
3: 23
4: 288
1093391525_1093391530 12 Left 1093391525 12:18629799-18629821 CCTAGGATAAACCCGAGATATTT 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1093391530 12:18629834-18629856 ATGATAGACATTTTATTCCTTGG 0: 1
1: 0
2: 0
3: 23
4: 288
1093391527_1093391530 0 Left 1093391527 12:18629811-18629833 CCGAGATATTTTCACTTTACCCT 0: 1
1: 0
2: 0
3: 28
4: 385
Right 1093391530 12:18629834-18629856 ATGATAGACATTTTATTCCTTGG 0: 1
1: 0
2: 0
3: 23
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093391530 Original CRISPR ATGATAGACATTTTATTCCT TGG Intronic