ID: 1093393582

View in Genome Browser
Species Human (GRCh38)
Location 12:18652770-18652792
Sequence TACTAGAAACCTAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093393577_1093393582 14 Left 1093393577 12:18652733-18652755 CCTTCAGGCTTTTTACATGTATA 0: 1
1: 0
2: 1
3: 30
4: 247
Right 1093393582 12:18652770-18652792 TACTAGAAACCTAATGAGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093393582 Original CRISPR TACTAGAAACCTAATGAGGT GGG Intergenic
903475134 1:23614283-23614305 TTCCAGGAACCTAATGAGGGTGG + Intronic
903897339 1:26616416-26616438 TTCCAACAACCTAATGAGGTAGG + Intergenic
906912426 1:49968732-49968754 AACTGGAAACCAAATGAGGCAGG - Intronic
908860939 1:68488369-68488391 TACTACAAAACAAATCAGGTTGG - Exonic
911004108 1:93199776-93199798 TACCAGAACGCAAATGAGGTGGG - Intronic
911629682 1:100168541-100168563 TATTCAAAACCTAATGAAGTTGG - Exonic
912965706 1:114235401-114235423 TACTAGAAAGCCAATGGGGTGGG - Intergenic
913714799 1:121522724-121522746 TACTAGAAAGCTACTGTGTTTGG - Intergenic
914679647 1:149930061-149930083 TAGTTGAAGCCTAATGAGGAGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917977406 1:180249153-180249175 TAATAAAAACCTCATGAGGTAGG - Intronic
918422622 1:184379475-184379497 GACTATTAACCTCATGAGGTAGG - Intergenic
920164624 1:204026778-204026800 AACAAGAAACCTAATCAGGTAGG - Intergenic
921882484 1:220271152-220271174 TGCTACAAACCAAATAAGGTTGG - Intronic
922129077 1:222758822-222758844 AATTAGAAACCTAGAGAGGTGGG + Intergenic
1063232876 10:4083149-4083171 TGCTAGAAAACTAAGGAGCTGGG - Intergenic
1063634497 10:7768719-7768741 TAAAAGAAACCTATTTAGGTGGG + Intronic
1063676679 10:8146527-8146549 CAATAGCAACCTAATGAAGTAGG - Intergenic
1064048328 10:12039143-12039165 TACTAAAATCTTTATGAGGTGGG + Intronic
1070912561 10:80131467-80131489 TACAAGAATCCTTATGAGTTGGG + Intergenic
1071296383 10:84223261-84223283 TACTTTCAAACTAATGAGGTAGG - Intronic
1072312593 10:94170981-94171003 TTCTAGTCACCTAATGAGGTGGG - Intronic
1073115157 10:101087706-101087728 TACTAAAGACTTAATGAAGTTGG - Intergenic
1078819756 11:14866088-14866110 TCACAGAAACCTTATGAGGTAGG - Intronic
1079379154 11:19921789-19921811 TGCTATAAATCCAATGAGGTAGG - Intronic
1079617067 11:22508572-22508594 CACTTCAAACCTAATGAGTTGGG - Intergenic
1082797986 11:57392150-57392172 TTTTAAAAACCTAGTGAGGTAGG + Intronic
1083144733 11:60749789-60749811 TTTTAAAAACCTTATGAGGTTGG - Intergenic
1085872742 11:80369477-80369499 TACAACAAACCCAAAGAGGTAGG + Intergenic
1086039814 11:82462601-82462623 TACTAGAAACCTATAGAGGTGGG + Intergenic
1086372542 11:86169468-86169490 TAACAGAAACCTTAAGAGGTAGG + Intergenic
1092277407 12:7072167-7072189 TACTAGAAGCCAAAAAAGGTTGG + Intergenic
1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG + Intergenic
1093393582 12:18652770-18652792 TACTAGAAACCTAATGAGGTGGG + Intergenic
1093679840 12:21989377-21989399 TATTATGACCCTAATGAGGTAGG - Intergenic
1095700104 12:45182422-45182444 TTTTAGAAACCTAAAGAGCTCGG - Intergenic
1097712429 12:62931750-62931772 TCATAAAAGCCTAATGAGGTAGG - Intronic
1099583552 12:84485213-84485235 TTCTAGCAACTTATTGAGGTAGG - Intergenic
1102429809 12:112874407-112874429 TACTAATAACCTTATGGGGTGGG - Intronic
1106512748 13:30425367-30425389 TACTAGAAACACAGTGAGGCAGG + Intergenic
1107638155 13:42414202-42414224 TTCTGGAAATCTTATGAGGTTGG - Intergenic
1108931256 13:55824844-55824866 TACTATAAACCTAATTATATTGG + Intergenic
1112668529 13:101607183-101607205 TCCTAAAAACACAATGAGGTAGG + Intronic
1118058167 14:62104823-62104845 TTTAAGACACCTAATGAGGTAGG - Exonic
1118253023 14:64181311-64181333 TGCTCTAAGCCTAATGAGGTAGG - Intronic
1124856793 15:33396928-33396950 TACCAGAAAAATAAAGAGGTTGG - Intronic
1127678512 15:61269597-61269619 TCCTAGAAAGCTAATGACTTTGG - Intergenic
1128749653 15:70139960-70139982 TACTTTAAGCCTCATGAGGTGGG - Intergenic
1129315428 15:74740270-74740292 TACTAGAAATCAAATGAAGCCGG + Intergenic
1130863480 15:87911461-87911483 TTCTAGAAACCCAATGGGGATGG + Intronic
1132153329 15:99477562-99477584 CACTAGAACCCCTATGAGGTGGG + Intergenic
1133475268 16:6115226-6115248 TACAAGAATCCTAGTTAGGTAGG - Intronic
1133568783 16:7021245-7021267 AAGTAGTAACCAAATGAGGTGGG - Intronic
1133636869 16:7675104-7675126 TACATTAAACTTAATGAGGTAGG - Intronic
1133910882 16:10065598-10065620 TTTTAAAAACCTTATGAGGTAGG - Intronic
1139695143 16:68668934-68668956 TCCTAATAACCTGATGAGGTAGG + Intronic
1143876718 17:9997157-9997179 TACTTGAAAAATATTGAGGTAGG + Intronic
1145930027 17:28678730-28678752 TACCAGAAACCTAGTGGGGGAGG - Intronic
1146202597 17:30872854-30872876 CACTAGAAACCTGAGGAGGTTGG - Intronic
1148082156 17:44973037-44973059 TAGTATTAACCTCATGAGGTAGG + Intergenic
1148298757 17:46527240-46527262 TATTAGAATACTAGTGAGGTAGG + Intronic
1149207240 17:54262638-54262660 TAAAAGTAACCTAATAAGGTAGG - Intergenic
1153358086 18:4160521-4160543 CACAATAAGCCTAATGAGGTAGG + Intronic
1156392895 18:36668048-36668070 TTCTAGAAAGCTAAAGAGGAAGG - Intronic
1159827724 18:73235314-73235336 TACAAGAAAATTAATGTGGTTGG - Intronic
1164926285 19:32132413-32132435 TATGAGATACCTCATGAGGTAGG + Intergenic
1165924304 19:39317715-39317737 TCATAGCAACCTTATGAGGTGGG - Intergenic
1166371763 19:42305719-42305741 TTCTAGCAACCAAATGAGGAAGG + Intronic
930567358 2:53038157-53038179 TATTAGTAACCTTATAAGGTAGG - Intergenic
930907909 2:56595099-56595121 TACTAAAAAACTCATGATGTAGG + Intergenic
931087514 2:58849622-58849644 TGGAAGAAAGCTAATGAGGTAGG - Intergenic
933739653 2:85523512-85523534 TGCAACAATCCTAATGAGGTAGG + Intergenic
934105102 2:88688245-88688267 TTCAAGAAACCTAATGAAATTGG - Intergenic
935573926 2:104689639-104689661 AACTAGAAACCCAATGACCTGGG - Intergenic
936936889 2:117847593-117847615 TACAAGAATCATGATGAGGTAGG - Intergenic
938260567 2:129892495-129892517 TGCTGGAGACCTAAAGAGGTCGG + Intergenic
940861637 2:158776342-158776364 TACTTGCAAGCTAATGAGTTAGG + Intergenic
941223162 2:162810462-162810484 TAATAGAAACCAAATGAAATAGG + Intronic
942832004 2:180248093-180248115 TAATAAAATCCTCATGAGGTAGG + Intergenic
944144796 2:196495377-196495399 TACTAGAAACCCTGTGAGCTGGG + Intronic
1172435229 20:34924266-34924288 TACTAGAATCCCCATGAGGGAGG - Intronic
1173555982 20:43966112-43966134 TACCAAGAACCTTATGAGGTAGG + Intronic
1176186766 20:63784424-63784446 TACTTGAACCCTGGTGAGGTGGG - Intronic
1180612381 22:17106395-17106417 GACTACAAGGCTAATGAGGTGGG - Intronic
949102708 3:165178-165200 TTTTAGGAACCTAATGAGGTTGG - Intergenic
951334890 3:21408507-21408529 TAAGAGAAACCTAATGTTGTGGG + Intergenic
954913628 3:54130566-54130588 TCCCAGCAACCTAATGAGGTAGG + Intronic
958815197 3:98906363-98906385 TACTGGAAACCTTAGGAGGATGG + Intergenic
961258534 3:125580212-125580234 TACTAAAAATCGAATGAGTTAGG + Intronic
961987043 3:131145840-131145862 CACAACAATCCTAATGAGGTAGG - Intronic
962892205 3:139681743-139681765 TACTAGAAAGCTAATGAATTGGG - Intergenic
963145365 3:141988515-141988537 TACCAGAAATCTACTGAGGCAGG - Intronic
963453033 3:145509002-145509024 TACTAAAAAACTTATGAAGTGGG + Intergenic
964305465 3:155334824-155334846 AACCAGAAACCTAATGAAGTTGG - Intergenic
965041495 3:163513627-163513649 TACTATGAACCTAATCAGTTAGG + Intergenic
965736782 3:171829134-171829156 TCCTACAAACCCAATGTGGTTGG - Intergenic
970658897 4:18262352-18262374 TACTAGAAACCAAAGGAGTTTGG + Intergenic
972877377 4:43379993-43380015 TGCTAGAAACTGAAAGAGGTAGG - Intergenic
973011208 4:45076448-45076470 CACTAGAAACCTAATTAAATTGG + Intergenic
973243599 4:47985900-47985922 TCAGAAAAACCTAATGAGGTAGG - Intronic
974573504 4:63687227-63687249 TACTAGAACCCTAAACTGGTAGG + Intergenic
975315767 4:72951342-72951364 TTCTAGAAGCCTCATGTGGTAGG - Intergenic
976138003 4:81959763-81959785 TACTGGAAGCCCAGTGAGGTAGG - Intronic
976338062 4:83913602-83913624 TACCAGAAATCTAATGAAGATGG - Intergenic
977264048 4:94833230-94833252 TACTAACAACCCTATGAGGTAGG - Intronic
979043102 4:115824908-115824930 CACTAGAAATCTCATAAGGTGGG - Intergenic
979841978 4:125452998-125453020 TACAAGAAAACTTATGAGGTAGG + Intronic
982213552 4:153060493-153060515 TAGTAGAAAAATAATGAGGCCGG + Intergenic
986444871 5:7812598-7812620 TAACTGAAACCCAATGAGGTAGG + Intronic
991174865 5:63675841-63675863 TACTAGAAAACTGATCAGGCTGG + Intergenic
991247233 5:64521062-64521084 AACTAGAAATCTCATGAGGGAGG - Intronic
991446205 5:66702740-66702762 TACCAGAGACCTAATCAGGTAGG + Intronic
992122064 5:73604877-73604899 TACTAGAAACCTATTGACTTAGG - Intergenic
993298788 5:86180704-86180726 AACTGGAAACCTCAGGAGGTAGG + Intergenic
993518489 5:88867481-88867503 TCCTCAAAACTTAATGAGGTAGG - Intronic
994047301 5:95324630-95324652 TCATAAAAACCCAATGAGGTTGG + Intergenic
997964139 5:138344703-138344725 TTCCAAAAACCTTATGAGGTAGG - Intronic
999657345 5:153823787-153823809 CACTAGAAATTTAAGGAGGTGGG + Intergenic
1000245496 5:159445643-159445665 TGCCACAAACCTTATGAGGTAGG + Intergenic
1001468905 5:171994348-171994370 CTGTAGTAACCTAATGAGGTAGG - Intronic
1003451577 6:6239301-6239323 TAGTAGCTACCTAATGAGGTGGG + Intronic
1004440564 6:15647584-15647606 TACTAAAACCATAATGAAGTGGG + Intronic
1005995270 6:30927013-30927035 TACTGAAAACCTCATGAGGCGGG + Intergenic
1011043032 6:83052125-83052147 TCCTAGCAACCATATGAGGTAGG + Intronic
1013737274 6:113242356-113242378 TACTAGAAAAATAATGAAATGGG + Intergenic
1014941388 6:127443890-127443912 TATTGGAAAACTAATGAGGATGG + Exonic
1015122795 6:129719365-129719387 TACTTTATACCCAATGAGGTAGG - Intergenic
1015129729 6:129795597-129795619 TGCTAGAAAGCAAATGAGCTGGG - Intergenic
1015408044 6:132859334-132859356 TACTAGAAAAATTATGAGTTTGG + Intergenic
1016998708 6:149979915-149979937 TACCAAAAACCTACTGAGTTTGG + Intergenic
1017128961 6:151091642-151091664 TCCCAGCACCCTAATGAGGTAGG - Intronic
1018037715 6:159895627-159895649 TATTTGATTCCTAATGAGGTTGG - Intergenic
1020721172 7:11747042-11747064 TTATAGAAAGCTAAAGAGGTCGG - Intronic
1021401661 7:20216771-20216793 TGCTATTAACCTAATGAGGTAGG + Intronic
1023499651 7:40833865-40833887 TAATTGAATCCTAATGAGTTTGG - Intronic
1024586532 7:50846552-50846574 TAATAGAAATTTAATGGGGTGGG + Intergenic
1027477689 7:78653848-78653870 TACTAAAAGTCTAATGAGGATGG - Intronic
1029946536 7:104539220-104539242 CAATAGAAAACTAATGAAGTGGG + Intronic
1031912363 7:127531722-127531744 TATTAGCAACATAATGAGTTTGG + Intergenic
1034142620 7:148836283-148836305 TACTAGAAATACAGTGAGGTGGG - Intronic
1034878572 7:154746397-154746419 TATTTGACACCTAATGAGGTGGG + Intronic
1042144159 8:65710834-65710856 AACTAGAAACTGAATGACGTGGG - Intronic
1042656647 8:71105841-71105863 TAATAGCAACCTTATGAGGCAGG - Intergenic
1043916002 8:85922668-85922690 TACAAGAAAATTACTGAGGTGGG - Intergenic
1045974517 8:108116232-108116254 ATCTAGAACTCTAATGAGGTAGG + Intergenic
1046160901 8:110363064-110363086 CACTAGAAATCTACTTAGGTGGG + Intergenic
1047218296 8:122897291-122897313 TTCTGGTAACCCAATGAGGTAGG - Intronic
1047553263 8:125900016-125900038 TCCTAGAAACCCCAAGAGGTAGG + Intergenic
1048768724 8:137871673-137871695 AACAAGAAACCTAATCAGATTGG + Intergenic
1051700810 9:19821669-19821691 TATTAGAAAATTAATGAGGATGG - Intergenic
1052354547 9:27490713-27490735 GTCAAGAAACCTAATTAGGTGGG - Intronic
1052581587 9:30362629-30362651 TAGTAAAAAGCTAATGAGCTGGG - Intergenic
1053125097 9:35574720-35574742 TACTATCAAGATAATGAGGTAGG + Intergenic
1055925061 9:81501505-81501527 TCCCTCAAACCTAATGAGGTAGG + Intergenic
1057648123 9:96896079-96896101 TACTGGAAACTTAATCAGGTGGG + Intergenic
1057894492 9:98896895-98896917 TACTAGAAATATAAAGATGTAGG + Intergenic
1059564933 9:115374563-115374585 TACTACCAATCTAATAAGGTAGG - Intronic
1061708568 9:132471569-132471591 TGCTATAAACATAATCAGGTAGG + Intronic
1187124522 X:16441883-16441905 TATTAGAAGGCTAAAGAGGTAGG - Intergenic
1187531124 X:20097963-20097985 AACTAGTAACCTAGTGAGATAGG - Intronic
1194188846 X:90809108-90809130 TACAACAAACCTAGTGAAGTAGG + Intergenic
1196118423 X:112022136-112022158 TACAAGAAATCTATGGAGGTAGG + Intronic
1197027910 X:121777601-121777623 TACAAGAATCCTTATGAGTTGGG + Intergenic
1200535428 Y:4391005-4391027 TACAACAAACCTAGTGAAGTAGG + Intergenic