ID: 1093393841

View in Genome Browser
Species Human (GRCh38)
Location 12:18656121-18656143
Sequence TTGCTGTTTTTGTGGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093393841_1093393845 -5 Left 1093393841 12:18656121-18656143 CCATTCTTCCACAAAAACAGCAA No data
Right 1093393845 12:18656139-18656161 AGCAAATATGCTGGGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093393841 Original CRISPR TTGCTGTTTTTGTGGAAGAA TGG (reversed) Intergenic
No off target data available for this crispr