ID: 1093396980

View in Genome Browser
Species Human (GRCh38)
Location 12:18694486-18694508
Sequence CTCCACAATTAGGCTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093396980_1093396984 -4 Left 1093396980 12:18694486-18694508 CCTACAAAAGCCTAATTGTGGAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1093396984 12:18694505-18694527 GGAGACTGAGGAAAAGAAAAGGG 0: 1
1: 0
2: 10
3: 166
4: 1355
1093396980_1093396985 13 Left 1093396980 12:18694486-18694508 CCTACAAAAGCCTAATTGTGGAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1093396985 12:18694522-18694544 AAAGGGCTCCTAAAATTTCCAGG 0: 1
1: 0
2: 1
3: 9
4: 152
1093396980_1093396987 29 Left 1093396980 12:18694486-18694508 CCTACAAAAGCCTAATTGTGGAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1093396987 12:18694538-18694560 TTCCAGGTAAAATTCATCAAAGG 0: 1
1: 0
2: 1
3: 25
4: 252
1093396980_1093396983 -5 Left 1093396980 12:18694486-18694508 CCTACAAAAGCCTAATTGTGGAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1093396983 12:18694504-18694526 TGGAGACTGAGGAAAAGAAAAGG 0: 1
1: 0
2: 8
3: 97
4: 993

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093396980 Original CRISPR CTCCACAATTAGGCTTTTGT AGG (reversed) Intronic
909840578 1:80316879-80316901 CTTCCCAATTATGCTTTTGGGGG - Intergenic
910109586 1:83668319-83668341 GTCCATAATTAGGCTAATGTGGG - Intergenic
912667093 1:111592025-111592047 CTCCAACATTAGGCATTTGGGGG + Intronic
913323643 1:117607289-117607311 GTCCATAGGTAGGCTTTTGTAGG + Intronic
919299229 1:195739625-195739647 CTGCACCATTAGGATTTTGTGGG - Intergenic
920490799 1:206413353-206413375 ACCCACAATTAGGCATTGGTTGG + Intronic
923090959 1:230740942-230740964 CTCAAAAATTAGGATTTTTTTGG + Intergenic
1065674949 10:28164405-28164427 ATCCACTATTAGGCTTTTCTTGG + Intronic
1072017210 10:91360034-91360056 CTCCACCTTTAGCCCTTTGTGGG + Intergenic
1073874468 10:107906275-107906297 CTCCAGAATTAGTATTCTGTTGG - Intergenic
1074090581 10:110250012-110250034 CTCCACCATTAGGCTTCCCTCGG - Intronic
1079478727 11:20858786-20858808 CTCCACAATTAACCGTTTGTAGG + Intronic
1081132765 11:39401197-39401219 CTCCACAATTTGGCCTTTCCTGG - Intergenic
1083601472 11:63951280-63951302 CTTAACACTTAGGCATTTGTGGG + Intronic
1083626101 11:64072862-64072884 CTCCACACGTAGGTTTATGTGGG - Intronic
1084346861 11:68558104-68558126 TTACACATTTATGCTTTTGTAGG + Intronic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1085225946 11:74921312-74921334 CTCCACAGTCAGGCTGTTGAAGG + Exonic
1089374501 11:117985096-117985118 CTCCTGAAGTAAGCTTTTGTTGG + Intergenic
1091147334 11:133291184-133291206 CTCCAAAATTTGCCTTTTGGTGG - Intronic
1093396980 12:18694486-18694508 CTCCACAATTAGGCTTTTGTAGG - Intronic
1093804599 12:23416676-23416698 CTCCACAATTAGCTTTTCCTGGG - Intergenic
1095364018 12:41380237-41380259 ATCCAAAATGAGTCTTTTGTGGG + Intronic
1096778390 12:53977878-53977900 CTCCAAAATCAGGCATTTGGAGG - Intergenic
1097689822 12:62724319-62724341 CTCCACACTTACCCTTATGTGGG - Intronic
1102990893 12:117315157-117315179 CTCCAAAATTAAGTTTTTGTTGG - Intronic
1109440499 13:62365277-62365299 CTACACAGTGAGTCTTTTGTTGG - Intergenic
1110751660 13:79121996-79122018 CTCCAGAGTGAGGCTATTGTGGG + Intergenic
1111001924 13:82195809-82195831 CTCCACACTGGGGCATTTGTGGG - Intergenic
1114233191 14:20802083-20802105 TTTCTCAATTAGGCTTTTCTGGG - Exonic
1115409957 14:33062701-33062723 CACCACAACGAGCCTTTTGTAGG + Intronic
1117316228 14:54573425-54573447 CTCTAGAATTAGACTTCTGTAGG - Intronic
1117764253 14:59063996-59064018 CTCCACATGTAGGCTTTTTGTGG - Intergenic
1118405104 14:65414116-65414138 CTACAGAATTTGGCTTTTCTGGG - Intronic
1118537392 14:66783057-66783079 CTAGACAAACAGGCTTTTGTAGG - Intronic
1124625784 15:31306831-31306853 CCCCACAATGTGGCTTTTGTCGG - Intergenic
1127329769 15:57927325-57927347 AGCCAGAATTTGGCTTTTGTGGG + Intergenic
1132215708 15:100060263-100060285 CTCAACAGTTAGACTTCTGTGGG + Intronic
1133604286 16:7370816-7370838 GTCCACAATTAGTCTTTGGTAGG + Intronic
1144543921 17:16174408-16174430 CTTGAAAATTATGCTTTTGTAGG - Intronic
1145121780 17:20266878-20266900 CTCCACACCTAGGCCTTGGTGGG - Intronic
1145203268 17:20966384-20966406 CTCCACACCTAGGCCTTGGTGGG - Intergenic
1147366096 17:39960270-39960292 ATCCACATTTAGGCTTGTCTTGG - Intergenic
1151730863 17:75910362-75910384 CTCCACAGGTAGACTGTTGTGGG - Intronic
1157994351 18:52537368-52537390 TTCTAAAATTAGGCTGTTGTGGG + Intronic
1159988885 18:74878531-74878553 CTCCACAATTATTCTTTAGAAGG - Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
928482720 2:31698689-31698711 ATCCACAATTATGCATTTATAGG + Intergenic
930481835 2:51958022-51958044 CTCCACACTCAAGCTTTTTTGGG + Intergenic
934017557 2:87904894-87904916 CTCCAGAGTTAGGCTAATGTGGG - Intergenic
941396765 2:164983053-164983075 CTCCACAAGTAAGCTTTATTGGG - Intergenic
941777439 2:169408144-169408166 CTCCACAATCAAGTTTTTATAGG + Intergenic
942103414 2:172608834-172608856 ATCCACAGATGGGCTTTTGTAGG + Intergenic
942989812 2:182186588-182186610 CTTCTCATTTTGGCTTTTGTAGG - Exonic
1169677383 20:8169237-8169259 CTCCATAATTGTTCTTTTGTAGG + Intronic
1171295008 20:24009648-24009670 CTCTAGAATTAGGCTTTCGGAGG - Intergenic
1171353017 20:24519426-24519448 CTCCACCATTTTGTTTTTGTGGG + Intronic
1173996841 20:47345204-47345226 CTCCTCAAAGAGGCTTTTGGTGG - Intronic
1179049548 21:37877154-37877176 TTCCCCAATTAGGCGTTGGTGGG - Intronic
1185235707 22:49711724-49711746 CTCTACATTTAGGATTTTGCTGG - Intergenic
951617185 3:24560374-24560396 CTGCACAATTCTGCTTTTCTAGG - Intergenic
955718060 3:61851811-61851833 CTCCACAATTATGCTACTGAAGG - Intronic
960292946 3:115908527-115908549 CTTCAGAATCAGGCTTTTGGAGG - Intronic
963978116 3:151505703-151505725 CTCCCAAATTAGTCTTTTCTAGG + Intergenic
966451209 3:180064193-180064215 TGCCAAAATGAGGCTTTTGTGGG + Intergenic
969055426 4:4398711-4398733 TTCCACATTTGGGCTGTTGTGGG + Intronic
970482180 4:16487512-16487534 CTGGAGAATTAGGCTTTTATCGG + Intergenic
970942827 4:21655340-21655362 CTCCTCATTTCGGCTTTTGATGG - Intronic
976622910 4:87147308-87147330 CTCCACAATTTTACTTTTTTAGG - Intergenic
976639241 4:87320183-87320205 CCCCTCAAATAGCCTTTTGTGGG + Intronic
977022620 4:91775647-91775669 CTCGAGAATCTGGCTTTTGTAGG - Intergenic
978096059 4:104780023-104780045 TTTTACAATTTGGCTTTTGTAGG + Intergenic
980752094 4:137104117-137104139 CTCCACATTTTAGCTATTGTGGG - Intergenic
983644230 4:169973430-169973452 CTCAATAATTAGTCTTCTGTTGG - Intergenic
987572170 5:19678008-19678030 CTCCACTATTAAGTCTTTGTAGG - Intronic
996987910 5:129590860-129590882 CTTCACAATTACATTTTTGTTGG + Intronic
997523281 5:134536898-134536920 ATCTACCCTTAGGCTTTTGTGGG - Intronic
997527706 5:134564019-134564041 TCCCACAATGAGGCTTTTCTTGG + Intronic
998748163 5:145285683-145285705 CTGCACAATTAGACTTTAGCAGG + Intergenic
999459373 5:151744764-151744786 CTCCACCCCTAGGGTTTTGTAGG - Intronic
1007854791 6:44844931-44844953 CCCCACAATAATGCTTTTGTTGG + Intronic
1009908891 6:69902752-69902774 CTCCACAATTAACCGTTGGTAGG - Intronic
1010505884 6:76658884-76658906 CACCACAGCTAGGGTTTTGTTGG + Intergenic
1012197474 6:96361891-96361913 AACTAAAATTAGGCTTTTGTAGG - Intergenic
1013070885 6:106728337-106728359 CTCCACATTCAGCCTTTTGAGGG + Intergenic
1016980017 6:149845427-149845449 CTCCAAAGTAAGGCTTTTGCAGG - Intronic
1018116861 6:160594789-160594811 CTGCACAACTAGGCTTTGATGGG - Intronic
1023299058 7:38749315-38749337 CTCAACAATTAGCCAATTGTTGG + Intronic
1025010128 7:55390069-55390091 CTGCACAATTAGGGCTTTGAGGG - Intronic
1027498556 7:78919200-78919222 CTTCTCACTTATGCTTTTGTTGG + Intronic
1027614438 7:80403905-80403927 CCCCACAATGAGGCATGTGTGGG - Intronic
1029095552 7:98082467-98082489 CTGCACAATCAGGCCTTTCTGGG + Intergenic
1029852256 7:103475290-103475312 CCCCACAACTAAACTTTTGTTGG + Intronic
1031515082 7:122690407-122690429 CTCCACAATTAGCCGTTCGTAGG - Intronic
1032189421 7:129755405-129755427 TGCCACAATTTGGCTTTTTTGGG - Exonic
1033056322 7:138058307-138058329 CTCCACAATTATCCTGTTGCTGG + Intronic
1033754988 7:144390954-144390976 AAAGACAATTAGGCTTTTGTTGG - Intergenic
1033858125 7:145590808-145590830 CTCCTCAATTATGCTTGTTTGGG - Intergenic
1034009715 7:147515872-147515894 CTACTGAATCAGGCTTTTGTAGG - Intronic
1037060197 8:14498329-14498351 CACCACAATTTGTATTTTGTTGG + Intronic
1037538741 8:19852237-19852259 TTCCATAGTTAGGCTTTGGTCGG + Intergenic
1038576855 8:28712006-28712028 CTCGAGGATTAGGCTTTGGTGGG + Intronic
1039662345 8:39481141-39481163 CTCCACCATGAGGCTTTAGCTGG + Intergenic
1040509476 8:48081332-48081354 CTCGCCAACTAGGCTTTTGATGG - Intergenic
1041229487 8:55734714-55734736 TTCCACATTTAAGTTTTTGTAGG - Intronic
1043919862 8:85969141-85969163 CTCCACACTTGGGCTTTTTAAGG - Intergenic
1047148755 8:122236849-122236871 TTCCTCAATAAGGCTTTTCTAGG - Intergenic
1047433121 8:124809781-124809803 CTCAACCATGAGGCTTCTGTGGG - Intergenic
1048073795 8:131046775-131046797 GTCACCACTTAGGCTTTTGTTGG + Intergenic
1058234317 9:102470228-102470250 CTCCAGGTTTAGGCTTTTGAAGG - Intergenic
1059208890 9:112492573-112492595 CTCCACATGTGGGATTTTGTTGG + Intronic
1059610625 9:115888978-115889000 CTTCACAATTGGCCTGTTGTGGG - Intergenic
1061557079 9:131377438-131377460 CTCCACAATTGTACTTTTGGAGG + Intergenic
1186747275 X:12583038-12583060 CTCCTCAATCAAGCTTTTCTTGG + Intronic
1190404382 X:50072009-50072031 CTGTACAATTAGGCGTTTGTGGG + Intronic
1192447701 X:71223164-71223186 CTGCACAATGAGACCTTTGTGGG - Intronic
1193507458 X:82362075-82362097 CTCCACAATTGATCATTTGTAGG - Intergenic
1193637013 X:83963557-83963579 GTCCACTGTTAGACTTTTGTAGG + Intergenic
1194560595 X:95414527-95414549 CTCAAGTATTATGCTTTTGTGGG + Intergenic
1194577719 X:95634817-95634839 TTCCAAAATTGGGCTTTTGAGGG - Intergenic
1196266312 X:113651399-113651421 TTCCACAAGTCGGCTTTTGCAGG - Intergenic
1197315686 X:124963022-124963044 CTCCAAAATATGGCTATTGTAGG + Intronic
1197840100 X:130737148-130737170 CTCCTAAATTAAGCTGTTGTTGG - Intronic
1198867323 X:141138284-141138306 CTTCACATATATGCTTTTGTGGG - Intergenic
1199126926 X:144133651-144133673 CTCCAGAGTTAGGCTAATGTGGG + Intergenic
1199476936 X:148256299-148256321 CTTCACAATTAAGTCTTTGTAGG + Intergenic
1201794855 Y:17883894-17883916 CTCCACAATTATGCCCTGGTGGG + Intergenic
1201806700 Y:18022091-18022113 CTCCACAATTATGCCCTGGTGGG - Intergenic
1202356227 Y:24051673-24051695 CTCCACAATTATGCCCTGGTGGG + Intergenic
1202514551 Y:25618436-25618458 CTCCACAATTATGCCCTGGTGGG - Intergenic