ID: 1093399091

View in Genome Browser
Species Human (GRCh38)
Location 12:18721562-18721584
Sequence CAGTGCCAAAGTAATTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093399085_1093399091 28 Left 1093399085 12:18721511-18721533 CCTCCATCCCAACATCTCATTTG 0: 1
1: 0
2: 1
3: 23
4: 278
Right 1093399091 12:18721562-18721584 CAGTGCCAAAGTAATTGTTTTGG 0: 1
1: 0
2: 1
3: 18
4: 158
1093399089_1093399091 -9 Left 1093399089 12:18721548-18721570 CCACCTGAAGTTTACAGTGCCAA 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1093399091 12:18721562-18721584 CAGTGCCAAAGTAATTGTTTTGG 0: 1
1: 0
2: 1
3: 18
4: 158
1093399087_1093399091 21 Left 1093399087 12:18721518-18721540 CCCAACATCTCATTTGTATCTTT 0: 1
1: 0
2: 1
3: 51
4: 440
Right 1093399091 12:18721562-18721584 CAGTGCCAAAGTAATTGTTTTGG 0: 1
1: 0
2: 1
3: 18
4: 158
1093399088_1093399091 20 Left 1093399088 12:18721519-18721541 CCAACATCTCATTTGTATCTTTT 0: 1
1: 0
2: 5
3: 37
4: 550
Right 1093399091 12:18721562-18721584 CAGTGCCAAAGTAATTGTTTTGG 0: 1
1: 0
2: 1
3: 18
4: 158
1093399086_1093399091 25 Left 1093399086 12:18721514-18721536 CCATCCCAACATCTCATTTGTAT 0: 1
1: 0
2: 0
3: 21
4: 267
Right 1093399091 12:18721562-18721584 CAGTGCCAAAGTAATTGTTTTGG 0: 1
1: 0
2: 1
3: 18
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093399091 Original CRISPR CAGTGCCAAAGTAATTGTTT TGG Intronic
901985645 1:13073587-13073609 CAGGGCCAAAGTCACTGCTTTGG - Intronic
901996164 1:13153180-13153202 CAGGGCCAAAGTCACTGCTTTGG + Intergenic
902030121 1:13416245-13416267 CAGGGCCAAAGTCATTGCTCTGG - Intronic
908340806 1:63177227-63177249 AAGTCCCAAAGAAAATGTTTTGG + Intergenic
909317510 1:74242191-74242213 CAATGCCAAAAAAGTTGTTTTGG - Intronic
910983385 1:92980812-92980834 CAGTGCTATTGTTATTGTTTTGG + Intergenic
911081375 1:93935154-93935176 TAGTGCCACAGTAATTATTAGGG + Intergenic
911263908 1:95720543-95720565 CAGTGCCAATGGAACTGTTGAGG - Intergenic
915254636 1:154617050-154617072 TAGTGCCCCAGTCATTGTTTTGG - Intronic
915666368 1:157448878-157448900 CAGTGCTGAAGTAGTTGTTATGG + Intergenic
919517865 1:198549970-198549992 CAGTGCCAGAATCATTGTTAAGG + Intergenic
920663898 1:207945090-207945112 CACTGCCAAATTAATGCTTTGGG - Intergenic
924851187 1:247832600-247832622 CAGTCAGAAAATAATTGTTTGGG - Intergenic
1065334053 10:24636796-24636818 AAGTGGCAAAGGAAGTGTTTTGG - Intronic
1070298948 10:75188909-75188931 CAGTGCCAAAGTCATGTTCTAGG + Intergenic
1071531676 10:86394401-86394423 CAGTGCCACAGTGAATGTCTTGG + Intergenic
1074368711 10:112881331-112881353 CATTTCCACAGCAATTGTTTTGG + Intergenic
1075154828 10:119966425-119966447 CAGTACCAAAGTAAATGAATAGG + Intergenic
1075940113 10:126384219-126384241 CAGTTGCAAAGTAAGTATTTTGG - Intronic
1079606822 11:22380055-22380077 CAGTGACAAAGACATTCTTTTGG - Intergenic
1080106273 11:28514180-28514202 CTTTGACACAGTAATTGTTTCGG + Intergenic
1080809222 11:35686242-35686264 TAGTGCCACAGTAAGTGTCTGGG - Intronic
1081216647 11:40407428-40407450 CATTGCTAAAGTAATTCTTCAGG + Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1085955492 11:81388633-81388655 CAGTCCTCAAGTAATTTTTTAGG + Intergenic
1087713996 11:101585502-101585524 CAGTGCCAAGGTAATCTCTTTGG + Intronic
1087883378 11:103446646-103446668 AAGAGCCAAAGGAATTTTTTTGG + Intronic
1089178529 11:116565154-116565176 AAGTGCCAAAATACATGTTTTGG - Intergenic
1093399091 12:18721562-18721584 CAGTGCCAAAGTAATTGTTTTGG + Intronic
1093975620 12:25418384-25418406 AAGTGCTAAACTAATTGCTTAGG + Intronic
1095560028 12:43553003-43553025 CAGAGCCACAGTAATTGTAGAGG - Intergenic
1098214097 12:68197668-68197690 CAGAGCTAAAGAAATAGTTTAGG - Intergenic
1099885391 12:88523814-88523836 AAGACCCAAATTAATTGTTTAGG - Intronic
1102789010 12:115628404-115628426 AATTGCCAAGGTAATGGTTTGGG - Intergenic
1106109147 13:26761172-26761194 CAGGGCCAAAAGAATTGCTTAGG + Intergenic
1106659755 13:31786340-31786362 TACTTCCAAAGTAATTGCTTTGG + Intronic
1108510278 13:51149220-51149242 CAGAGCCAAATTAAATGATTTGG - Intergenic
1109505485 13:63296501-63296523 AGGTTACAAAGTAATTGTTTAGG - Intergenic
1110681908 13:78323802-78323824 CAGTGACATAGTAAGTGTTCAGG + Intergenic
1111088389 13:83407581-83407603 CATTGCCAATGTAATTGTATTGG + Intergenic
1111473258 13:88713913-88713935 CATTTCCACAGTCATTGTTTAGG + Intergenic
1111690606 13:91558656-91558678 CATTGCCAAAGAAACTCTTTAGG - Intronic
1111807063 13:93051003-93051025 CATTGGCAAAAGAATTGTTTAGG - Intergenic
1115117361 14:29897476-29897498 CAGTGGAAAAGCAAGTGTTTTGG + Intronic
1115797505 14:36955336-36955358 CAGTACAAAAGTAATCCTTTGGG - Intronic
1116990790 14:51274125-51274147 TAGTTCTAAAGAAATTGTTTAGG - Intergenic
1119056665 14:71428972-71428994 CAGCTCCAAAATAATTATTTTGG + Intronic
1121204980 14:92156824-92156846 GAATGCCAAAGTAATTGAATTGG + Intronic
1126282072 15:46965124-46965146 CAGTGACAATTTAATTGATTTGG - Intergenic
1127157465 15:56143133-56143155 CACTGACAAAGTATTTGTTTTGG + Intronic
1129499337 15:76020539-76020561 CAGTGGAAAAATAATTGTCTTGG + Intronic
1134021742 16:10925802-10925824 CAGTGGAAAATTAATTGTTTGGG + Exonic
1135579351 16:23612170-23612192 CAGTGGGAAAGTAGTTGTCTAGG - Intronic
1141243026 16:82280485-82280507 CTGTGCCAAAGGAATAGATTTGG - Intergenic
1143494223 17:7302299-7302321 CAGTGCCATATTATTTGTTGTGG - Intergenic
1144615597 17:16768469-16768491 CAGTGCCAAAGCAGTTGTTATGG + Intronic
1144841814 17:18191351-18191373 CAGTGCCAAAGTCATTTTTGTGG + Intronic
1144897108 17:18547198-18547220 CAGTGCCAAAGCAGTTGTTATGG - Intergenic
1149110412 17:53021443-53021465 AAGTGTTTAAGTAATTGTTTTGG - Intergenic
1153020430 18:623870-623892 CAGTGCCCAGGTGATTCTTTGGG + Intronic
1154002737 18:10497326-10497348 CAGTGAAAAAGTAATTGTCAAGG - Intergenic
1155869178 18:31004573-31004595 CAATGCCAAATTATTTCTTTAGG - Intronic
1156901293 18:42303026-42303048 CACAGGCAAAGTAAATGTTTGGG - Intergenic
1157315363 18:46583335-46583357 CTGTGCAAAAGTTTTTGTTTGGG - Intronic
1158571411 18:58599675-58599697 CAGTTCCAAAATTATAGTTTGGG + Intronic
1162622801 19:11857820-11857842 TAGTGCCTAAGTAATGGTATGGG + Intronic
1165679046 19:37757565-37757587 CAGTGTAAAAGTAATTTTTAAGG - Intronic
1167012974 19:46821247-46821269 CAGGCCTAAAATAATTGTTTTGG - Intergenic
928879960 2:36086904-36086926 CAGTACCAAAGCCATTGGTTGGG - Intergenic
933563474 2:83919118-83919140 CAGTGCCAGAGTGATGGTTTTGG + Intergenic
935511427 2:103980638-103980660 CTGTACCACAGTAATTCTTTTGG + Intergenic
935744938 2:106182191-106182213 CAGTGGAAAAATAATTGTCTTGG + Intronic
936072295 2:109379292-109379314 CAGTGCCAAAGTAATAATCCAGG + Intronic
936585100 2:113750151-113750173 CATTGCCACATTAATTGATTTGG + Intronic
936877242 2:117205513-117205535 GACTTCCAAAGTAATTATTTGGG - Intergenic
937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG + Exonic
937624696 2:124030509-124030531 CAGTGTCAAAGTGAATGTTTTGG - Intronic
939718212 2:145612755-145612777 CAGGGCCATAGTACTTCTTTGGG + Intergenic
939866999 2:147483770-147483792 CAGTGCCAGAGGAAGCGTTTTGG - Intergenic
940047680 2:149426821-149426843 CAGTGCCAAAGACATTGGGTGGG + Intronic
940620735 2:156109941-156109963 CAATGCCACAGCATTTGTTTAGG - Intergenic
941520304 2:166534073-166534095 CAGAGCCAGAGTCAGTGTTTCGG + Intergenic
944432282 2:199646203-199646225 CAGTGTCAAAGTTACTGATTTGG + Intergenic
945382419 2:209156961-209156983 CATTGCAAAAGTAATTTCTTAGG + Intergenic
945736481 2:213607365-213607387 CAGTGCCTAAGTAATATATTAGG + Intronic
947257759 2:228183760-228183782 CAGTGTCAGAGGAATTGTTGTGG + Intergenic
947514457 2:230789932-230789954 CTGTTTCAAAGTCATTGTTTTGG + Intronic
948281905 2:236753331-236753353 CAGTGCCAAAATAAGGGATTTGG - Intergenic
948719286 2:239888228-239888250 AACTGCCAATGTAATGGTTTGGG + Intergenic
1169866249 20:10203129-10203151 CAGTTACAAAGAAATTGGTTGGG + Intergenic
1170312467 20:15007688-15007710 CAGTTCCAGAGTATTTGTTCCGG - Intronic
1170485227 20:16808781-16808803 GAGTGACAAATTAATTCTTTTGG + Intergenic
1172426236 20:34858080-34858102 CTGTGCCACAGTGATTGATTTGG + Intronic
1173056777 20:39622306-39622328 GAATGCCAAAGTAATTGTACTGG + Intergenic
1174928685 20:54789190-54789212 TTGTGCCAAAGTAACTGGTTAGG - Intergenic
1181981144 22:26767419-26767441 CAGTCCCAAGTAAATTGTTTTGG - Intergenic
1181997995 22:26898055-26898077 CATTTCAAAAATAATTGTTTTGG + Intergenic
950884446 3:16350824-16350846 CAGAACCAAAGTAATTATCTTGG + Intronic
952619002 3:35313479-35313501 CATTGCCAAAATAATTTCTTAGG + Intergenic
957733914 3:84181194-84181216 CCCAGCCAGAGTAATTGTTTAGG - Intergenic
958715862 3:97779432-97779454 AAGTGCAAAAATAAATGTTTTGG - Intronic
958906305 3:99945690-99945712 AAATGCCAAAATAATTGTCTGGG - Intronic
966408300 3:179622121-179622143 CCATGCCCAACTAATTGTTTAGG + Intronic
967490080 3:190080311-190080333 GAGTGCCATAGTAAGAGTTTTGG + Intronic
968931821 4:3584447-3584469 CAGTGCCCAAGTACTTGGTCAGG + Intronic
970860994 4:20701903-20701925 AAGTGAAAAAGCAATTGTTTTGG + Intronic
970878519 4:20900556-20900578 TAGTGGAAAACTAATTGTTTTGG - Intronic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
971712722 4:30137527-30137549 CAGTGCCATTGTAACTGTTCTGG - Intergenic
971806740 4:31368103-31368125 CTGAGCCAAGGTAATTGTTGTGG - Intergenic
973341256 4:49007045-49007067 CACTACTAGAGTAATTGTTTAGG + Intronic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
975050780 4:69862182-69862204 AAAAGCCACAGTAATTGTTTTGG - Intergenic
976864124 4:89703720-89703742 CACTGCTAAAGTAACTGTCTAGG - Intergenic
977392585 4:96430607-96430629 AAGTTCCAAAGTAATTCTTCTGG + Intergenic
977787935 4:101061209-101061231 CAATGCCAGAGTAATAGTTAAGG - Intronic
980828913 4:138105970-138105992 TGGTGCAAAAGTAATTGTTTTGG - Intergenic
981857466 4:149311424-149311446 AATTGCCAATGTAATTGTATTGG - Intergenic
982806361 4:159769711-159769733 AAGTGCCAAGGTAATTGTATTGG + Intergenic
983214412 4:164989935-164989957 CTATGCCAAAGTAATTGTCCAGG - Intergenic
985374982 4:189325707-189325729 CATTGCCAAAGTCAATGTTCAGG + Intergenic
986993153 5:13577751-13577773 CAGTGTCAAATTACTTGTATGGG + Intergenic
987632373 5:20491537-20491559 AAGAGCCAAAGTTATTGTCTAGG + Intronic
988179656 5:27773394-27773416 CACTGCCAAAGAATTTCTTTAGG - Intergenic
991201635 5:64000957-64000979 CTGTCCCAAAGTAACTGTTTTGG - Intergenic
991502931 5:67295125-67295147 AAGTGCAAAAGTAACTGATTGGG + Intergenic
995355942 5:111237978-111238000 CACTGTCAAAGTAATTATTCTGG + Intronic
997479216 5:134170878-134170900 CAATGCCAAAGCAAGTATTTAGG + Intronic
997519100 5:134511245-134511267 CAGTGCTGAAGTATTTGCTTTGG - Intergenic
997627940 5:135343779-135343801 CAGCCTCAAAATAATTGTTTTGG + Exonic
1000074466 5:157772089-157772111 CATTGCAAAATTAATTATTTAGG - Intergenic
1000156305 5:158555469-158555491 CAGTGCCTTAGTAAGAGTTTTGG - Intergenic
1002778204 6:346741-346763 CAGTGCAAGAGGAACTGTTTCGG - Intronic
1003138187 6:3449057-3449079 CACTGCCAAACTAAATGTTTAGG + Intronic
1008145207 6:47883304-47883326 AAGTGCCAATATAATTTTTTAGG - Intronic
1009356249 6:62749976-62749998 TTGTGCAAAAGCAATTGTTTGGG + Intergenic
1011022628 6:82831503-82831525 CAGTGCCTCAGGAATAGTTTAGG - Intergenic
1011050341 6:83141082-83141104 CATTCCCTAATTAATTGTTTAGG - Intronic
1015410343 6:132886788-132886810 CAGGGCTAAAGGAATTATTTGGG + Intergenic
1015834933 6:137410172-137410194 AAGTGCCAAAGCAACTGTTAGGG + Intergenic
1022592361 7:31676880-31676902 CAATGCCAAAGTCATTTCTTAGG - Intergenic
1028407798 7:90495188-90495210 CAGTGACTAAATTATTGTTTTGG + Intronic
1029141217 7:98411853-98411875 TAGTGCAAAAGTAATTGTGGGGG + Intergenic
1032578714 7:133082819-133082841 CAGTGTAAAAGTGATTGCTTTGG + Intergenic
1037159756 8:15754630-15754652 CAATGCCAAAGTACTTGCTTGGG + Intronic
1037159816 8:15755673-15755695 CAGTGCCAAAGTAGTTGCTTGGG - Intronic
1038657900 8:29470855-29470877 CATTGCCAATGTAATTGTATTGG - Intergenic
1039526613 8:38222150-38222172 TACTGGCAAAGTAATTTTTTAGG + Intergenic
1039629604 8:39095387-39095409 CATTGACCAAGTGATTGTTTAGG + Intronic
1041282179 8:56221681-56221703 CAATGACAAACTAATTGTTTTGG + Intergenic
1041594524 8:59632959-59632981 CAGAGTTAAAGTAATTGTTTTGG - Intergenic
1045721689 8:105119096-105119118 CAATGCCAAAGGAATTTCTTTGG - Intronic
1045799269 8:106082935-106082957 CTGATCCAAAGTAAATGTTTTGG + Intergenic
1046755056 8:117964066-117964088 CATTGCCAAAGAAACTGCTTTGG + Intronic
1047722193 8:127651527-127651549 AAGTGAAAAAGTAATTGTTGGGG - Intergenic
1047810004 8:128398223-128398245 TAGTGATAAAGTAATTGTTTGGG - Intergenic
1049365203 8:142233699-142233721 CAGTGCCTAGGTTATGGTTTTGG + Intronic
1053746481 9:41203446-41203468 CAGTCACAAAGGAATTTTTTGGG - Intergenic
1054681864 9:68227832-68227854 CAGTCACAAAGGAATTTTTTGGG + Intergenic
1055284455 9:74713362-74713384 CAGCTCCAAATTAATTGTTCTGG - Intergenic
1055861950 9:80762299-80762321 AAATGCTAAAGTAATTGCTTTGG - Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1202782611 9_KI270718v1_random:14221-14243 CAGTCACAAAGGAATTTTTTGGG - Intergenic
1186582671 X:10837652-10837674 CAGAGCCAGAGGAATTGCTTTGG - Intergenic
1188296368 X:28455028-28455050 CAGTGCCAAAAGTATTGATTTGG + Intergenic
1188445852 X:30252481-30252503 CAATCCCAAAGTAACTGTTAAGG - Intergenic
1189387233 X:40547101-40547123 CAGTTCGAAAGCCATTGTTTTGG - Intergenic
1190072807 X:47292839-47292861 CAGTGGAAAATTAAATGTTTTGG + Intergenic
1190475659 X:50824713-50824735 AAGTGTCAGGGTAATTGTTTGGG - Intergenic
1191116927 X:56862488-56862510 CAGTGCGGAAGAAATTGTTATGG - Intergenic
1194494219 X:94590759-94590781 CAGTGGCAAAGTAACGGCTTTGG + Intergenic
1195144330 X:101998427-101998449 CAGTACAAAAGTAATTGTGAGGG + Intergenic
1195522878 X:105850918-105850940 CAGTTCCAAAGTCACTTTTTGGG + Intronic
1199750785 X:150815709-150815731 CAGGGAAAATGTAATTGTTTAGG - Intronic
1200361890 X:155615832-155615854 CACTGCAAAATTAATTGTATAGG - Intronic
1201437447 Y:13974878-13974900 CAGTACCAAAGTAATTTTATGGG + Intergenic
1201714143 Y:17025263-17025285 CTTTACCAAAGTAGTTGTTTTGG - Intergenic