ID: 1093406996

View in Genome Browser
Species Human (GRCh38)
Location 12:18816592-18816614
Sequence GACAGTATATTCAGAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093406996_1093407001 12 Left 1093406996 12:18816592-18816614 CCTGAAATTCTGAATATACTGTC No data
Right 1093407001 12:18816627-18816649 AATGGCATCCTGGATTTTATGGG No data
1093406996_1093406999 2 Left 1093406996 12:18816592-18816614 CCTGAAATTCTGAATATACTGTC No data
Right 1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG No data
1093406996_1093407000 11 Left 1093406996 12:18816592-18816614 CCTGAAATTCTGAATATACTGTC No data
Right 1093407000 12:18816626-18816648 AAATGGCATCCTGGATTTTATGG No data
1093406996_1093406998 -6 Left 1093406996 12:18816592-18816614 CCTGAAATTCTGAATATACTGTC No data
Right 1093406998 12:18816609-18816631 ACTGTCTTGTGGTTATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093406996 Original CRISPR GACAGTATATTCAGAATTTC AGG (reversed) Intergenic
No off target data available for this crispr