ID: 1093406999

View in Genome Browser
Species Human (GRCh38)
Location 12:18816617-18816639
Sequence GTGGTTATAAAATGGCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093406996_1093406999 2 Left 1093406996 12:18816592-18816614 CCTGAAATTCTGAATATACTGTC No data
Right 1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093406999 Original CRISPR GTGGTTATAAAATGGCATCC TGG Intergenic
No off target data available for this crispr