ID: 1093411608

View in Genome Browser
Species Human (GRCh38)
Location 12:18875162-18875184
Sequence CGTTCTAGGGCACCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093411600_1093411608 29 Left 1093411600 12:18875110-18875132 CCATCCATTTCTTAAGCAAACTT No data
Right 1093411608 12:18875162-18875184 CGTTCTAGGGCACCACAAGCTGG No data
1093411603_1093411608 1 Left 1093411603 12:18875138-18875160 CCAGTTTATTTTCCATAATGTAA No data
Right 1093411608 12:18875162-18875184 CGTTCTAGGGCACCACAAGCTGG No data
1093411602_1093411608 6 Left 1093411602 12:18875133-18875155 CCTTTCCAGTTTATTTTCCATAA No data
Right 1093411608 12:18875162-18875184 CGTTCTAGGGCACCACAAGCTGG No data
1093411601_1093411608 25 Left 1093411601 12:18875114-18875136 CCATTTCTTAAGCAAACTTCCTT No data
Right 1093411608 12:18875162-18875184 CGTTCTAGGGCACCACAAGCTGG No data
1093411599_1093411608 30 Left 1093411599 12:18875109-18875131 CCCATCCATTTCTTAAGCAAACT No data
Right 1093411608 12:18875162-18875184 CGTTCTAGGGCACCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093411608 Original CRISPR CGTTCTAGGGCACCACAAGC TGG Intergenic
No off target data available for this crispr