ID: 1093415144

View in Genome Browser
Species Human (GRCh38)
Location 12:18911298-18911320
Sequence TTTGACTCCCTGGGCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093415140_1093415144 2 Left 1093415140 12:18911273-18911295 CCTTTTAGGCTGAGTGGAGCCAC No data
Right 1093415144 12:18911298-18911320 TTTGACTCCCTGGGCAAAGCTGG No data
1093415137_1093415144 18 Left 1093415137 12:18911257-18911279 CCAATCTAAATCTAGACCTTTTA No data
Right 1093415144 12:18911298-18911320 TTTGACTCCCTGGGCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093415144 Original CRISPR TTTGACTCCCTGGGCAAAGC TGG Intergenic
No off target data available for this crispr