ID: 1093423768

View in Genome Browser
Species Human (GRCh38)
Location 12:19004432-19004454
Sequence AAGTGGAACTAGGGCGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093423768_1093423775 18 Left 1093423768 12:19004432-19004454 CCCTCTTCGCCCTAGTTCCACTT No data
Right 1093423775 12:19004473-19004495 TGTCTCCTTTGCAGAAAGAAGGG No data
1093423768_1093423774 17 Left 1093423768 12:19004432-19004454 CCCTCTTCGCCCTAGTTCCACTT No data
Right 1093423774 12:19004472-19004494 GTGTCTCCTTTGCAGAAAGAAGG No data
1093423768_1093423777 25 Left 1093423768 12:19004432-19004454 CCCTCTTCGCCCTAGTTCCACTT No data
Right 1093423777 12:19004480-19004502 TTTGCAGAAAGAAGGGACAAAGG No data
1093423768_1093423778 26 Left 1093423768 12:19004432-19004454 CCCTCTTCGCCCTAGTTCCACTT No data
Right 1093423778 12:19004481-19004503 TTGCAGAAAGAAGGGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093423768 Original CRISPR AAGTGGAACTAGGGCGAAGA GGG (reversed) Intergenic
No off target data available for this crispr