ID: 1093426950

View in Genome Browser
Species Human (GRCh38)
Location 12:19038428-19038450
Sequence TAAGTTTGATGTCCTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093426948_1093426950 12 Left 1093426948 12:19038393-19038415 CCAGGCGGCAGAGTGTGAAATCA No data
Right 1093426950 12:19038428-19038450 TAAGTTTGATGTCCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093426950 Original CRISPR TAAGTTTGATGTCCTCTGCC TGG Intergenic
No off target data available for this crispr