ID: 1093428158

View in Genome Browser
Species Human (GRCh38)
Location 12:19052683-19052705
Sequence CTGGTTACTCAGATAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093428154_1093428158 9 Left 1093428154 12:19052651-19052673 CCTGGCAGCACTATTTTCTTAAC No data
Right 1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093428158 Original CRISPR CTGGTTACTCAGATAGCACA TGG Intergenic
No off target data available for this crispr