ID: 1093435317

View in Genome Browser
Species Human (GRCh38)
Location 12:19129657-19129679
Sequence CGCGCGCGCCCTACCCCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093435317_1093435324 -10 Left 1093435317 12:19129657-19129679 CCCGAGGGGGTAGGGCGCGCGCG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1093435324 12:19129670-19129692 GGCGCGCGCGGGGGCGCGCCGGG 0: 1
1: 1
2: 10
3: 109
4: 751
1093435317_1093435325 -6 Left 1093435317 12:19129657-19129679 CCCGAGGGGGTAGGGCGCGCGCG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1093435325 12:19129674-19129696 CGCGCGGGGGCGCGCCGGGCCGG 0: 1
1: 0
2: 14
3: 114
4: 709
1093435317_1093435327 -4 Left 1093435317 12:19129657-19129679 CCCGAGGGGGTAGGGCGCGCGCG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1093435327 12:19129676-19129698 CGCGGGGGCGCGCCGGGCCGGGG 0: 1
1: 0
2: 5
3: 113
4: 730
1093435317_1093435326 -5 Left 1093435317 12:19129657-19129679 CCCGAGGGGGTAGGGCGCGCGCG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1093435326 12:19129675-19129697 GCGCGGGGGCGCGCCGGGCCGGG 0: 1
1: 1
2: 11
3: 143
4: 959
1093435317_1093435328 -1 Left 1093435317 12:19129657-19129679 CCCGAGGGGGTAGGGCGCGCGCG 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1093435328 12:19129679-19129701 GGGGGCGCGCCGGGCCGGGGAGG 0: 1
1: 1
2: 46
3: 238
4: 1647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093435317 Original CRISPR CGCGCGCGCCCTACCCCCTC GGG (reversed) Intergenic
901109917 1:6785821-6785843 CGCGAGCCCCCCGCCCCCTCCGG - Intronic
901483141 1:9539767-9539789 CGCGCGCGCCCCACCGCCTGCGG + Intronic
904045154 1:27604182-27604204 CGCGCGCGCGCTCCCCCCTGGGG - Intronic
907341213 1:53737858-53737880 CGCGCGCCCACGACCTCCTCCGG - Intergenic
909496586 1:76285907-76285929 CCCGCGCCCCCTCCCCCATCTGG + Intronic
921189906 1:212699874-212699896 CGCGCCGGCCCCGCCCCCTCAGG + Exonic
922951113 1:229558906-229558928 CGAGCGCCCCCAACCCGCTCGGG + Intergenic
923217654 1:231864370-231864392 TGCGCCCGGCCCACCCCCTCAGG - Intronic
923328453 1:232900808-232900830 AGTGAGCGCCCTAACCCCTCAGG - Intergenic
1071444680 10:85734951-85734973 GGCGAGCGCCAGACCCCCTCAGG - Intronic
1071997732 10:91163548-91163570 CGCTCGGGCCCTTCCCCCGCCGG + Intronic
1073137988 10:101230149-101230171 AGCGGCCGCCCTACCTCCTCCGG + Intergenic
1074819600 10:117168339-117168361 CGAGCGCGCACCACGCCCTCGGG + Intergenic
1074843039 10:117374505-117374527 CGCGCGTGCCCTTCACCCACTGG - Exonic
1082802821 11:57427001-57427023 CGAGCGCGGCCTGGCCCCTCGGG - Intronic
1083562200 11:63681770-63681792 CCCGCGCGCCTTACCCGCACAGG - Exonic
1088522227 11:110712298-110712320 CCCGCGCGTCCTCGCCCCTCCGG - Exonic
1092462240 12:8697459-8697481 CACGAGCCCCCTACCCCCTCGGG - Intronic
1092843036 12:12561844-12561866 CGCACGCCCCCTTCCCGCTCCGG + Intronic
1093435317 12:19129657-19129679 CGCGCGCGCCCTACCCCCTCGGG - Intergenic
1095206265 12:39443302-39443324 TGAGTGCGCCCTGCCCCCTCCGG + Intronic
1101150317 12:101877564-101877586 AGCCCGCGCCCCACCCACTCTGG + Exonic
1105071311 12:133235791-133235813 CCCGCGCGCCCCTCACCCTCCGG + Exonic
1108313853 13:49219996-49220018 CGCACGAGCCCTACCCGGTCCGG - Intergenic
1113494261 13:110714838-110714860 CGCCCCCGCCCAGCCCCCTCCGG + Intronic
1121352404 14:93184430-93184452 CCCGCGCGCCCTGCCCCCAGCGG + Intronic
1126134666 15:45378533-45378555 CGCGCCCGCCCACCCCGCTCCGG - Exonic
1128583031 15:68821530-68821552 CCCGCGCGCCCCTTCCCCTCCGG + Intronic
1132722756 16:1324896-1324918 GGCGCCCGCCCAACCCCCCCAGG - Exonic
1132793356 16:1706134-1706156 CGCGCGGGCACCGCCCCCTCCGG + Intergenic
1136129610 16:28211664-28211686 CGCCCGGGCCCGACCCCCGCGGG + Exonic
1139719931 16:68844038-68844060 CGCGGGCGCCCTACCCTCTCTGG - Intronic
1142136391 16:88453706-88453728 TCCGCGCGCCCGACCCCCGCCGG + Intronic
1144340881 17:14309551-14309573 CGGGCGCGCCCCGCCCCCGCCGG + Intronic
1145236751 17:21213966-21213988 CGCGCTCCCCCTACCCTCGCCGG - Intronic
1146053009 17:29567466-29567488 CGCGCGCGCGCTCTGCCCTCGGG + Intronic
1146398520 17:32486845-32486867 CGCGCGCGCCGTCCACGCTCCGG - Exonic
1148035495 17:44656638-44656660 TGCCCGCGCCCTCACCCCTCAGG + Exonic
1148684739 17:49495187-49495209 CCCGCCCGCCCTGCCGCCTCGGG - Intergenic
1151979104 17:77498501-77498523 CGCCCGCCCCCCACCCCCACAGG + Exonic
1152357352 17:79813552-79813574 AGCGCCCGCCCGCCCCCCTCCGG - Intergenic
1156448656 18:37254237-37254259 CGCCCGCCCCCCACCCCCGCCGG + Intronic
1160204723 18:76822952-76822974 TGCGCGCGCCCTGCCCCCGCTGG + Intronic
1160991683 19:1862876-1862898 CGCGCGCGCCCCACCCACCGAGG + Intronic
1161051288 19:2165103-2165125 CGCACGCGCCCCGCCTCCTCAGG - Intronic
1161080286 19:2307151-2307173 CGCCCGCTCCCCACCCCCGCCGG + Intronic
1161318014 19:3627254-3627276 CGCGCCCGCCCTCTGCCCTCTGG - Intergenic
1163036427 19:14571842-14571864 CACCCGCGCCCCACGCCCTCTGG + Intronic
1165349491 19:35268429-35268451 CGCGCGCGCCCGCCCGCCCCCGG + Intergenic
1167058827 19:47130850-47130872 CGCGCGCCACCTACCGCCGCCGG - Exonic
1167493127 19:49803085-49803107 CTTGCGCCCCCTGCCCCCTCAGG + Exonic
1168155442 19:54471557-54471579 AGCGCGCGCCCGCCCCGCTCTGG - Exonic
1168305640 19:55433627-55433649 CGCCCGCGCCCAACCCCCGGCGG - Exonic
938790865 2:134674500-134674522 CGCGCGCGCGCTACCATATCTGG + Intronic
940987330 2:160062517-160062539 CCTCCGCGCCCCACCCCCTCCGG + Exonic
941916710 2:170818075-170818097 CCCGTGCGCCCTCCCCCCGCTGG + Intronic
941967948 2:171318542-171318564 TGCACTCGCCCCACCCCCTCAGG - Exonic
948958562 2:241315000-241315022 CGCCCGCGCCCATCCCGCTCAGG + Intronic
1172143948 20:32743392-32743414 GGCGCGCGCCCCAGCCCCGCAGG + Exonic
1172661833 20:36573770-36573792 CGCGCGCCCCCACCCCCATCTGG - Intronic
1172697997 20:36835542-36835564 CGCCCGCCCCCTCCCCACTCGGG + Intronic
1172803995 20:37598323-37598345 CGCGCGCTCCCTCCCCCTGCAGG + Intergenic
1175847411 20:62065918-62065940 CGCGCGCCCCCGCCCCCCGCCGG - Intergenic
1176301453 21:5101000-5101022 CGCCCGGGCCCTTCCCTCTCAGG + Intergenic
1179225084 21:39445817-39445839 TGCGCGCGCCCAGCCCCCGCAGG - Intergenic
1179855578 21:44160899-44160921 CGCCCGGGCCCTTCCCTCTCAGG - Intergenic
1184101565 22:42343922-42343944 CGCCCGCGCCCCTCCCCCGCCGG - Intergenic
954614762 3:51964033-51964055 CGCGGGTGCCCAGCCCCCTCTGG + Intronic
961688360 3:128650820-128650842 CGCCCGGGCCCTACCCGCCCTGG - Exonic
962222233 3:133573736-133573758 CGCGCGTGCCTTTTCCCCTCAGG + Exonic
973820382 4:54657741-54657763 CGCGCGCGCCCTCCTCCTCCCGG + Intergenic
981468197 4:145098266-145098288 CGCGCGCGCACTACGTCCTATGG + Exonic
990955214 5:61333044-61333066 CGCGCGCGCCCGCACCCCTGCGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1004504663 6:16238412-16238434 CGCCCCCGTCCTTCCCCCTCAGG - Intergenic
1006472205 6:34235577-34235599 CGCCCGCTCCCCACCCCCACCGG + Intergenic
1018400442 6:163415005-163415027 CGCGCTCGCCCGCCCCCCGCAGG - Exonic
1020066220 7:5190375-5190397 CGCGCGCGCCCTCCCCGGCCGGG + Exonic
1021998333 7:26201626-26201648 CGCGCGGCCCCTCCCCCCGCCGG + Intronic
1023703135 7:42912033-42912055 CGCGCGAGCCCCGCCGCCTCGGG + Exonic
1027773992 7:82443251-82443273 CGCTCGCTCCCCACCCCCACGGG + Intronic
1034985339 7:155509787-155509809 CCCGCGCGCCCCTCTCCCTCCGG + Intronic
1037313086 8:17576839-17576861 AGCGCCCGCCCCACCTCCTCAGG - Intronic
1038039197 8:23709835-23709857 CGCGCTCGCCCCACCCCTGCAGG + Intergenic
1044306399 8:90645744-90645766 CGCGCTCGCCCCGCCCCCGCGGG + Exonic
1047998381 8:130357897-130357919 CGGGGGCGCCACACCCCCTCAGG - Intronic
1049807744 8:144548537-144548559 TGGGCACGCCCCACCCCCTCGGG + Intronic
1053397430 9:37787197-37787219 CCCGCGTGCCCCACCCGCTCTGG - Intronic
1058885832 9:109320668-109320690 CGAGCGCGCCCTCCCGCCTGCGG - Exonic
1060147904 9:121268105-121268127 CGCCCGCGCCCTGCCCACCCCGG + Intronic
1060554857 9:124503017-124503039 CCCCCACCCCCTACCCCCTCAGG + Intronic
1061880471 9:133566486-133566508 CGGGCGCGCCCTGCCCTCTGTGG - Intronic
1062621011 9:137422724-137422746 CGCGCCCGCCCTGCCCTCCCCGG - Intronic
1200036282 X:153333986-153334008 CGCGCGCGCCGCTCCCCCGCAGG + Intergenic
1200233536 X:154457971-154457993 CGCCCGCGCCACACCCCCTCGGG - Intergenic