ID: 1093435983

View in Genome Browser
Species Human (GRCh38)
Location 12:19135540-19135562
Sequence TATCCAAAGCTTAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093435983_1093435986 14 Left 1093435983 12:19135540-19135562 CCTCCCTCTTTAAGCTTTGGATA 0: 1
1: 0
2: 1
3: 5
4: 132
Right 1093435986 12:19135577-19135599 AGTATGATGTATGTAGTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 102
1093435983_1093435987 15 Left 1093435983 12:19135540-19135562 CCTCCCTCTTTAAGCTTTGGATA 0: 1
1: 0
2: 1
3: 5
4: 132
Right 1093435987 12:19135578-19135600 GTATGATGTATGTAGTGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093435983 Original CRISPR TATCCAAAGCTTAAAGAGGG AGG (reversed) Intronic
902156497 1:14491922-14491944 TATGAAAAGATTAAAAAGGGAGG - Intergenic
904650688 1:32003703-32003725 AATCAAACGCTTAAAGAGGCAGG + Intergenic
907794561 1:57702334-57702356 TATCCATAGCTTCAAAAGGGTGG - Intronic
907825918 1:58016828-58016850 TATCTTAAGCTTGGAGAGGGTGG - Intronic
907926148 1:58956816-58956838 TATACCCAGCTCAAAGAGGGCGG + Intergenic
914913234 1:151802921-151802943 TATCCAGGGCTGGAAGAGGGAGG - Intronic
917056299 1:170985726-170985748 TAACCAAGGCTTGGAGAGGGGGG - Intronic
919103378 1:193121238-193121260 CATCCAAAGAATGAAGAGGGAGG + Intergenic
921955634 1:220980693-220980715 GATCCACAGCTTCCAGAGGGAGG + Intergenic
924631958 1:245749655-245749677 TATCAAAAGCCTAAAGAGAAAGG + Exonic
1064587082 10:16850012-16850034 TCTCGAAAGCGTAAAGAGGCTGG - Intronic
1064967871 10:21033375-21033397 TATTTAAAGCCTAAAGATGGGGG + Intronic
1065220602 10:23492234-23492256 TATAAAAAGCTTAGAGAGGCTGG + Intergenic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1070501674 10:77078509-77078531 TATCCAGAGATTAAAGAGAAAGG - Intronic
1071929420 10:90451103-90451125 TAGCCATGGGTTAAAGAGGGAGG - Intergenic
1074286088 10:112099629-112099651 AAACCAAAGCTAAAAGAAGGAGG + Intergenic
1074977173 10:118590878-118590900 TATAAAGAGCTTAAAGAGGTTGG - Exonic
1078624323 11:12940082-12940104 TTTCCACAGCCTAAACAGGGAGG + Intronic
1078910085 11:15723053-15723075 TCTCCATAGCTTCCAGAGGGTGG - Intergenic
1080433868 11:32222173-32222195 AAGCCAAAGCTTGCAGAGGGTGG - Intergenic
1080514631 11:33008733-33008755 TATACAAAGGTAAAAGGGGGTGG + Intergenic
1084449171 11:69223064-69223086 TTGCCAAAGGTTAAGGAGGGTGG - Intergenic
1086522450 11:87685325-87685347 TATTGAAAGATTAAAGATGGTGG - Intergenic
1087170135 11:95041569-95041591 TCTCCAAAGGTTGAAGATGGGGG - Intergenic
1087322783 11:96683716-96683738 TTTCCAAAGCTTTAATAGGTGGG - Intergenic
1091144890 11:133270291-133270313 TAGCTAAAGCTTATAGAGTGAGG - Intronic
1093435983 12:19135540-19135562 TATCCAAAGCTTAAAGAGGGAGG - Intronic
1099586744 12:84526802-84526824 TAGCCAAAGCCTAAAAAGAGGGG + Intergenic
1100128186 12:91456248-91456270 TAAACATAGCTAAAAGAGGGGGG - Intergenic
1100813169 12:98360484-98360506 TAGCCAGAGCTTAAGGAGGTAGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1105596215 13:21841752-21841774 TCTCCAAAGCTTACAGAGGGTGG + Intergenic
1105858993 13:24393193-24393215 CAGCCACAGCTTAAAGCGGGCGG - Intergenic
1110037405 13:70705711-70705733 CATCAAAAGCTTAAAGAAGAAGG + Intergenic
1110098307 13:71560677-71560699 TGTACAGAGCTTAGAGAGGGAGG - Intronic
1110920561 13:81079401-81079423 TATCCACATTTTAAAGATGGAGG - Intergenic
1111539032 13:89647371-89647393 TTTCCAAAACTTGAAGAGGAAGG + Intergenic
1114303908 14:21403525-21403547 CTTCCAAAGCTTAAAGCTGGTGG - Exonic
1119460615 14:74799308-74799330 TATCCAAAGGTGGAAGAGGTGGG - Exonic
1121077953 14:91084924-91084946 TTTTCAAAGTTAAAAGAGGGTGG + Intronic
1121256221 14:92532240-92532262 GAACCTAGGCTTAAAGAGGGAGG + Intronic
1123986655 15:25652473-25652495 TACCCAAGGCTTGGAGAGGGAGG + Intergenic
1126633029 15:50756587-50756609 TATCAAGAGCTAAAAGGGGGTGG + Intronic
1130198897 15:81807207-81807229 AATAAAAAGTTTAAAGAGGGAGG - Intergenic
1131749373 15:95490095-95490117 TATCCACAACTTAAACAGGGAGG + Intergenic
1137396618 16:48120057-48120079 TTTCCAGAGCTTAAAGATGATGG + Intronic
1143440002 17:6963554-6963576 TTTCCAAAAATTAAAGAGGAGGG + Intronic
1148399848 17:47347644-47347666 TATTAAAAGATTGAAGAGGGTGG + Intronic
1149475632 17:56959032-56959054 TAGCTGAAGCTTAAAGGGGGTGG + Intronic
1153461281 18:5336315-5336337 TATCCAAGGCTTAAGGAGATTGG - Intergenic
1155683960 18:28523928-28523950 TTTCAAAAGCTTAAAGACAGAGG - Intergenic
1155777184 18:29779478-29779500 TATCTACAACTTAAAGATGGTGG - Intergenic
1159361528 18:67410848-67410870 TTTCCAAAGCTTCTGGAGGGAGG + Intergenic
1159495347 18:69195521-69195543 TACCAGAAGATTAAAGAGGGAGG - Intergenic
1164802487 19:31089185-31089207 CATCCAAGGCTGAAAGAGAGTGG + Intergenic
926489848 2:13511953-13511975 TATCCAAAGGATAAAGCAGGTGG + Intergenic
926905379 2:17800555-17800577 AAACCAAAGTTCAAAGAGGGAGG - Intergenic
929846269 2:45531970-45531992 TATCAGAAGATTGAAGAGGGTGG - Intronic
929903716 2:46027915-46027937 AATCCCAACCTTCAAGAGGGAGG - Intronic
931224192 2:60315538-60315560 AAACCAAGGCTTAAAGAGGTCGG + Intergenic
933897493 2:86824850-86824872 TATTCAAACCTTAAAAACGGTGG - Intronic
934534806 2:95124214-95124236 TTGCCAAAGGTTAAAGATGGTGG - Intronic
935190354 2:100772857-100772879 TTTCCAAAGCTAAAAGAGGAGGG + Intergenic
935307114 2:101747692-101747714 TATCCAAAGCTAAGAAGGGGGGG - Intronic
936281528 2:111144564-111144586 TATCCAAAGCTTACAAGAGGAGG - Intronic
939198941 2:139010126-139010148 TAGCCAAAGCAAAAAGAAGGAGG - Intergenic
939722319 2:145669214-145669236 TATGCAAAGCTCTAAGAGAGAGG + Intergenic
941247080 2:163112311-163112333 GATCCAAAGCTGAATGAGGTGGG + Intergenic
943307747 2:186286739-186286761 CATCAATAGATTAAAGAGGGTGG - Intergenic
947991691 2:234493253-234493275 TTTCCAAAGCTCACGGAGGGAGG + Exonic
1169313074 20:4564144-4564166 TAGCCTAAGCTAGAAGAGGGAGG + Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1172382954 20:34512108-34512130 TATTAAAAGCTGAAAGAGTGAGG - Intergenic
1174715432 20:52752724-52752746 AATACAAAGCTAAAAAAGGGAGG + Intergenic
1177602171 21:23329934-23329956 TCCCCAAATCTTAAAGAGCGAGG + Intergenic
1179353914 21:40640746-40640768 TATCCAAAGTTTACAGAGAAAGG + Intronic
1183230850 22:36581074-36581096 TAACCAAAGATTAAGGAGCGTGG - Intronic
1184476780 22:44726461-44726483 CAGCCAAGGCTTAAAGGGGGAGG - Intronic
953492244 3:43362163-43362185 TCTCCAAGGCTTACAGAGGATGG + Intronic
953796418 3:45989456-45989478 TTCCCAGAGCTTCAAGAGGGTGG + Intronic
955700157 3:61674294-61674316 AATCCAAAACTGAAAGAGCGGGG - Intronic
958139790 3:89547609-89547631 ACTCCAAAACTTAAAGAAGGTGG + Intergenic
959206435 3:103312882-103312904 TATAGAAAGTTTATAGAGGGAGG + Intergenic
965726363 3:171720811-171720833 AATCCAAAGTTTAAAAAGAGGGG + Intronic
966464565 3:180215536-180215558 AATCAAAAGATTAAAGAAGGCGG + Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969686040 4:8674819-8674841 TATCCCCAGCTCAGAGAGGGTGG + Intergenic
970786434 4:19803057-19803079 TATCCAAAACTAAAGGAGAGAGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972809969 4:42572796-42572818 TATCCACATCTTAAAGAGTAGGG + Intronic
974660921 4:64887773-64887795 TATCTAAAGCTGAGATAGGGTGG - Intergenic
975600517 4:76095159-76095181 AATCCAGAGTTTAAATAGGGAGG + Intronic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
978120621 4:105074707-105074729 TACCCAAAGCAGAGAGAGGGAGG - Intergenic
982618577 4:157675040-157675062 TGACTAAAGGTTAAAGAGGGTGG - Intergenic
983607076 4:169599708-169599730 TAAGGAAAGCTCAAAGAGGGTGG - Intronic
984438978 4:179741499-179741521 TATCCAAAGCTGAGATAGGCAGG + Intergenic
987123876 5:14793178-14793200 TTACCAAAGTTTAAGGAGGGAGG + Intronic
987576033 5:19730023-19730045 CATCCAAAGCAGAAAGAAGGTGG - Intronic
989172976 5:38492128-38492150 TATTCAGAGCTTCAAGAGGCTGG - Intronic
993284015 5:85966242-85966264 TATTCAAAGTTTGAAGAGGTTGG - Intergenic
994210069 5:97077789-97077811 TAACCATAGATTAATGAGGGAGG - Intergenic
995223591 5:109678513-109678535 TATATTAAGGTTAAAGAGGGAGG + Intergenic
998940468 5:147276679-147276701 TAGCATAAGCTTAATGAGGGTGG - Intronic
999777244 5:154821191-154821213 TATCAGAAGCTTAAGGAGGGAGG + Intronic
1002316159 5:178344999-178345021 TATCCTCAGCTTCATGAGGGTGG - Intronic
1003972053 6:11309125-11309147 TATCCAAAGTTTAAAAACAGGGG - Intronic
1004348812 6:14872937-14872959 TATCCAAAGATTAATGAAGATGG - Intergenic
1019570629 7:1710346-1710368 TCTCCACAGCTTTTAGAGGGAGG + Intronic
1021211365 7:17857342-17857364 TTTCCAAAAATTAAAGAGGAAGG + Intronic
1023393479 7:39732113-39732135 CATCCACAGCTTTAAGATGGGGG - Intergenic
1028715949 7:93968818-93968840 TATACAAAGTTCAAAGAAGGTGG + Intronic
1030156713 7:106462607-106462629 TTTCCATAGCTTGGAGAGGGAGG + Intergenic
1030624598 7:111830940-111830962 AATCCTAAGCCTAAGGAGGGAGG - Intronic
1033736583 7:144228439-144228461 TATCCTAACATTAAAGGGGGGGG - Intergenic
1040077590 8:43254009-43254031 TATCCAAAGGTTTAAGAATGAGG + Intergenic
1042294137 8:67201773-67201795 TATCCCCAGCTTGAATAGGGAGG - Intronic
1042664537 8:71191332-71191354 TAGCAAAAGCTTCAAGAGTGAGG + Intergenic
1043413497 8:80024760-80024782 TATGCAAAGGATGAAGAGGGTGG + Intronic
1043778572 8:84302477-84302499 TATAAAAAGAGTAAAGAGGGTGG - Intronic
1044632492 8:94292912-94292934 TATCCAAAGCTAACTGAGGTAGG - Intergenic
1045298104 8:100889688-100889710 GATCCCAAGCTTAAGGTGGGAGG + Intergenic
1048676432 8:136788263-136788285 TATCCAAATATTAGGGAGGGAGG + Intergenic
1049047305 8:140163078-140163100 TCTCCAGAGCTGAAAGAGTGTGG - Intronic
1055655166 9:78443969-78443991 TTTCCAGAGCTTAACGAGGTAGG + Intergenic
1055890401 9:81117727-81117749 GATCCATAGATTAAAGAGGGGGG - Intergenic
1056183715 9:84111042-84111064 TTTCCAAAGCTCAGAGAGGCTGG - Intergenic
1059083160 9:111271683-111271705 TCTCAAAAGCTTCAAAAGGGTGG - Intergenic
1186733400 X:12434597-12434619 CATTCAAAGCTTACAGAGGCTGG - Intronic
1187085662 X:16040633-16040655 CATCCAAAGGGTAAAGAGGCTGG + Intergenic
1188256625 X:27968831-27968853 TTTCCAAATCTTTAAAAGGGAGG + Intergenic
1194143684 X:90237160-90237182 TACACAAAGCTTCAAGAAGGGGG + Intergenic
1194887677 X:99337550-99337572 TTTCCAAAAATTAAAGAGGAGGG - Intergenic
1199243689 X:145577681-145577703 TATCCACATCTTAAAGAAGCTGG + Intergenic
1199376851 X:147122926-147122948 TAGCCAAAACTTAAAAAGTGGGG + Intergenic
1199989946 X:152981698-152981720 AATCCAAAGCTAAAGGAGTGGGG - Intergenic
1200489440 Y:3806456-3806478 TACACAAAGCTTCAAGAAGGGGG + Intergenic
1201454777 Y:14158095-14158117 TAACAAAAGCTTAAAGCAGGAGG - Intergenic